SubtiBank SubtiBank
ycnK [2019-09-03 11:04:29]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ycnK [2019-09-03 11:04:29]

copper-responsive transcription repressor of the [gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]-[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]-[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI] operon, [SW|DeoR family]
21.29 kDa
protein length
190 aa Sequence Blast
gene length
573 bp Sequence Blast
regulation of copper uptake
transcription repressor, [SW|DeoR family]

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Copper]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    448,461 449,033

    Phenotypes of a mutant

  • elevated expression of ''[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]'' under conditions of copper excess [Pubmed|19168619]
  • The protein

    Catalyzed reaction/ biological activity

  • repression of ''[gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]-[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]-[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]'' expression in the presence of excess copper [Pubmed|22904286,19168619]
  • Protein family

  • DeoR family of transcription factors
  • [SW|Cofactors]

  • copper acts as corepressor [Pubmed|19168619]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22904286], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|98D807FBB847BF731B5C236557C8F70347279CE0|YcnK]: repression, [Pubmed|22904286,19168619], in [regulon|98D807FBB847BF731B5C236557C8F70347279CE0|YcnK regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by copper limitation ([protein|search|YcnK]) [Pubmed|22904286,19168619]
  • view in new tab

    Biological materials


  • MGNA-C017 (ycnK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03960 ([gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATACACCCTCTTCAT, downstream forward: _UP4_TAACACAACACATACAGCGG
  • BKK03960 ([gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATACACCCTCTTCAT, downstream forward: _UP4_TAACACAACACATACAGCGG
  • labs

  • [SW|Mohamed Marahiel], Marburg University, Germany [ homepage]
  • References


  • 22918892,25209494
  • Original publications

  • 19168619,22904286,22383849,15101989