SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to nitrilotriacetate monooxygenase component B
22.44 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,717,999 3,718,616

    The protein

    Protein family

  • flavoredoxin family (with [protein|C30BB71F5DF257ED4A77DFD34EAEF2C05F0F9216|YdfE], according to UniProt)
  • Structure

  • [PDB|3BPK] (from B. cereus, 55% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A571 (ywrF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36080 ([gene|98D13FCE1FD5EB9C6581F5416F7B4FD40805E047|ywrF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCAACAACCGCCTTTA, downstream forward: _UP4_TGAAGAGAAGGACTATTTAA
  • BKK36080 ([gene|98D13FCE1FD5EB9C6581F5416F7B4FD40805E047|ywrF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCAACAACCGCCTTTA, downstream forward: _UP4_TGAAGAGAAGGACTATTTAA