SubtiBank SubtiBank
ywrF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywrF

similar to nitrilotriacetate monooxygenase component B
locus
BSU_36080
pI
5.00
mw
22.44 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,717,999 3,718,616

    The protein

    Protein family

  • flavoredoxin family (with [protein|C30BB71F5DF257ED4A77DFD34EAEF2C05F0F9216|YdfE], according to UniProt)
  • Structure

  • [PDB|3BPK] (from B. cereus, 55% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|98D13FCE1FD5EB9C6581F5416F7B4FD40805E047|ywrF]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A571 (ywrF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/571 NBRP B. subtilis, Japan]
  • BKE36080 ([gene|98D13FCE1FD5EB9C6581F5416F7B4FD40805E047|ywrF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCAACAACCGCCTTTA, downstream forward: _UP4_TGAAGAGAAGGACTATTTAA
  • BKK36080 ([gene|98D13FCE1FD5EB9C6581F5416F7B4FD40805E047|ywrF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCAACAACCGCCTTTA, downstream forward: _UP4_TGAAGAGAAGGACTATTTAA