SubtiBank SubtiBank
ypbS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypbS

unknown
locus
BSU_22020
pI
8.15
mw
9.75 kDa
protein length
gene length
258 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,312,207 2,312,464

    Expression and Regulation

    Operons

    genes
    [gene|9899D0CC5FF530A48532A653075494686796564D|ypbS]-[gene|BD8D1EBA85928C4ECA4FF50556FC7C59F9BC0E9D|ypzF]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|22F930B371A833BAEA84B32FADBB2BBA0B91A53B|dynA]-[gene|9899D0CC5FF530A48532A653075494686796564D|ypbS]-[gene|BD8D1EBA85928C4ECA4FF50556FC7C59F9BC0E9D|ypzF]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8396117], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B273 (ypbS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1272 NBRP B. subtilis, Japan]
  • BKE22020 ([gene|9899D0CC5FF530A48532A653075494686796564D|ypbS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATCGTTCATCTCGCT, downstream forward: _UP4_TAAGCTGGATGATCCTGTCG
  • BKK22020 ([gene|9899D0CC5FF530A48532A653075494686796564D|ypbS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATCGTTCATCTCGCT, downstream forward: _UP4_TAAGCTGGATGATCCTGTCG