SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


two-component response regulator ([SW|OmpR family]), induction of [gene|464DD1855E6B3195EE242637612A16C73FF32FC0|psdA]-[gene|AC7F08DC1DF7DD2F9AFF84041D357B286B1244AC|psdB] in response to lipid II-binding lantibiotics (nisin and gallidermin) and internal antimicrobial peptides ([protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC], [protein|DDB0022F50999AC52809D651C9CC5A5FDC71302C|SkfA])
27.37 kDa
protein length
237 aa Sequence Blast
gene length
714 bp Sequence Blast
resistance against toxic peptides
two-component response regulator ([SW|OmpR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    3,567,422 3,568,135

    The protein

    Protein family

  • [SW|OmpR family] of two-component response regulators
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 3-116) (according to UniProt)
  • Modification

  • phosphorylated by [protein|A9525886E911164BDFF0A55DA9F5FDD1C1B7A3B6|PsdS] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • Structure

  • [PDB|5DCL] (from Streptococcus agalactiae, 42% identity) [pubmed|26930060]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21078927], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|985E7F25C809AA5DF372101E64960DF704EED53F|PsdR]: activation, [Pubmed|21078927], in [regulon|985E7F25C809AA5DF372101E64960DF704EED53F|PsdR regulon]
  • regulation

  • ''[protein|search|psdA]'': induced by nisin, gallidermin ([protein|search|PsdR]) [Pubmed|21078927]
  • view in new tab

    Biological materials


  • MGNA-B637 (yvcP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34720 ([gene|985E7F25C809AA5DF372101E64960DF704EED53F|psdR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTGATCCCCCTTATAT, downstream forward: _UP4_GTCAATCGGAAGGATGAAGC
  • BKK34720 ([gene|985E7F25C809AA5DF372101E64960DF704EED53F|psdR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTGATCCCCCTTATAT, downstream forward: _UP4_GTCAATCGGAAGGATGAAGC
  • References

  • 10094672,18394148,14651641,21283517,23504016,21078927,26364265,27188294,27997719,26930060