SubtiBank SubtiBank
sipU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sipU

signal peptidase I
locus
BSU_04010
pI
9.84
mw
21.04 kDa
protein length
187 aa Sequence Blast
gene length
564 bp Sequence Blast
function
protein secretion
product
signal peptidase I
essential
no
synonyms
ycsB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    454,029 454,592

    The protein

    Catalyzed reaction/ biological activity

  • Cleavage of hydrophobic, N-terminal signal or leader sequences from secreted and periplasmic proteins (according to UniProt)
  • Protein family

  • [SW|peptidase S26 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|ADEEA5E15C100C1DC6E129B9A3E6DECAFCA8C409|SipV], [protein|C2EAE417DB9250B88BB0E25D4AE760BDE82EFD86|SipT], [protein|CDC6971F39F3EEAAE912CB1402EE1BD64D5A12A0|SipS]
  • Structure

  • [PDB|4NV4] (from B. anthracis, 41% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|9824F9CF9C2028AF267AC43FE7FD8590E8231AB8|sipU]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE04010 ([gene|9824F9CF9C2028AF267AC43FE7FD8590E8231AB8|sipU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTCCTTCACCCGATGC, downstream forward: _UP4_TAAAATGCAATGCAAAAAGA
  • BKK04010 ([gene|9824F9CF9C2028AF267AC43FE7FD8590E8231AB8|sipU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTCCTTCACCCGATGC, downstream forward: _UP4_TAAAATGCAATGCAAAAAGA
  • labs

  • [SW|Jan Maarten van Dijl], Groningen, Netherlands
  • References

    Reviews

  • 22688815
  • Original publications

  • 9325333,9694797,28088521