SubtiBank SubtiBank
resC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

resC

part of heam translocase, required for cytochrome c synthesis
locus
BSU_23130
pI
9.56
mw
39.61 kDa
protein length
391 aa Sequence Blast
gene length
1176 bp Sequence Blast
function
cytochrome c biogenesis
product
part of the [protein|495721E4B8BF6FEC01E62E86339560F90776EED1|ResB]-[protein|97FE84CF968596AC39D19EE2E43DA625147FD702|ResC] haem translocase
essential
no
synonyms
ypxC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.4|Respiration/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,417,984 2,419,159

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • haem-binding protein, translocation of haem from the cytoplasmic to the extracytoplasmic site of the membrane [Pubmed|19682263]
  • Protein family

  • CcmF/CycK/Ccl1/NrfE/CcsA family (single member, according to UniProt)
  • [SW|Localization]

  • cytoplasma membrane [Pubmed|19682263]
  • Expression and Regulation

    Operons

    genes
    [gene|5CD1E266B0EC82546A2AF19A05490DD4D04F812C|rluB]-[gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]-[gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]-[gene|97FE84CF968596AC39D19EE2E43DA625147FD702|resC]-[gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]-[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]-[gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]-[gene|97FE84CF968596AC39D19EE2E43DA625147FD702|resC]-[gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]-[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]
    description
    [Pubmed|8631715]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8631715], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [PubMed|8631715,11222591], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9988472], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16825793], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8631715,11222591 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE23130 ([gene|97FE84CF968596AC39D19EE2E43DA625147FD702|resC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCCATGACATCACTCCCTT, downstream forward: _UP4_TAGTCCTTTGAAAGCGACAC
  • BKK23130 ([gene|97FE84CF968596AC39D19EE2E43DA625147FD702|resC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCCATGACATCACTCCCTT, downstream forward: _UP4_TAGTCCTTTGAAAGCGACAC
  • References

  • 10844653,19682263,8631715,11222591,9988472,17706591,16825793,28189581