SubtiBank SubtiBank
yvaF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvaF

Uncharacterized HTH-type transcriptional regulator
locus
BSU_33580
pI
4.70
mw
21.85 kDa
protein length
190 aa Sequence Blast
gene length
573 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    3,449,049 3,449,621

    The protein

    [SW|Domains]

  • [SW|HTH tetR-type domain] (aa 1-58) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|97CE9735931D02E6E780C955C9BE3A67E5C4C59A|yvaF]-[gene|230D790937DAFB82A04B8597699115E1C1EAE98E|yvaE]-[gene|B7FBC30B744D8B1F26AFC5DCB297FAFAB5C60FB7|yvaD]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A446 (yvaF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/446 NBRP B. subtilis, Japan]
  • BKE33580 ([gene|97CE9735931D02E6E780C955C9BE3A67E5C4C59A|yvaF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTAATCCCCCGCTTTC, downstream forward: _UP4_GCTGATGAGGAGGCTGATGC
  • BKK33580 ([gene|97CE9735931D02E6E780C955C9BE3A67E5C4C59A|yvaF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTAATCCCCCGCTTTC, downstream forward: _UP4_GCTGATGAGGAGGCTGATGC