SubtiBank SubtiBank
dctR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dctR

two-component response regulator, regulation of the [gene|9A96572B101358768EB20EE9438BE0E1424A4130|dctS]-[gene|97C34F6FA0B89D93369150E9A8AB3579332B07BC|dctR]-[gene|search|dctP ]operon
locus
BSU_04460
pI
8.60
mw
25.39 kDa
protein length
226 aa Sequence Blast
gene length
681 bp Sequence Blast
function
regulation of the [gene|9A96572B101358768EB20EE9438BE0E1424A4130|dctS]-[gene|97C34F6FA0B89D93369150E9A8AB3579332B07BC|dctR]-[gene|search|dctP ]operon
product
two-component response regulator
essential
no
synonyms
ydbG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    499,365 500,045

    The protein

    [SW|Domains]

  • [SW|Response regulatory domain] (aa 7-123) (according to UniProt)
  • Modification

  • phosphorylated by [protein|9A96572B101358768EB20EE9438BE0E1424A4130|DctS] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • Structure

  • [PDB|4HYE] (Spr1814 from Streptococcus pneumoniae, 30% identity) [pubmed|23545256]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|9A96572B101358768EB20EE9438BE0E1424A4130|dctS]-[gene|97C34F6FA0B89D93369150E9A8AB3579332B07BC|dctR]-[gene|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP]
    description
    [Pubmed|10708364]

    regulation

  • part of the iron sparing response, strong down-regulation in a'' [protein|search|fur]'' mutant ([protein|search|Fur], [protein|search|FsrA]) [Pubmed|22389480]
  • view in new tab

    Biological materials

    Mutant

  • BKE04460 ([gene|97C34F6FA0B89D93369150E9A8AB3579332B07BC|dctR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAATGAGCAGAACCTTCC, downstream forward: _UP4_TAAACCTGAGACCAAAAAGA
  • BKK04460 ([gene|97C34F6FA0B89D93369150E9A8AB3579332B07BC|dctR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAATGAGCAGAACCTTCC, downstream forward: _UP4_TAAACCTGAGACCAAAAAGA
  • References

  • 10094672,10708364,23545256