SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


probably part of the [SW|stressosome], negative regulator of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity
31.66 kDa
protein length
278 aa Sequence Blast
gene length
837 bp Sequence Blast
control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity
[protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR] paralog

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    2,562,966 2,563,802

    The protein

    Paralogous protein(s)

  • [protein|F53C527995909A1CFA72C7BF919DD10EE175C6D7|RsbRB], [protein|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|RsbRC], [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR], [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA]
  • [SW|Domains]

  • [SW|STAS domain] (aa 160-271) (according to UniProt)
  • Modification

  • phosphorylation on Thr-181 by [protein|ADC52A22950736A0435AEEEC43F7407878786A81|RsbT] [Pubmed|21362065]
  • Expression and Regulation


    (according to [ DBTBS]) null

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • expressed under stress conditions ([protein|search|SigB]) [Pubmed|10482513,20019076]
  • view in new tab

    Biological materials


  • MGNA-C475 (yqhA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24760 ([gene|979D7A45EAD97C99015029400A85795061BAA367|rsbRD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAATGAGTTACCTCC, downstream forward: _UP4_TGATGCCTTTGCCATGTTTA
  • BKK24760 ([gene|979D7A45EAD97C99015029400A85795061BAA367|rsbRD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAATGAGTTACCTCC, downstream forward: _UP4_TGATGCCTTTGCCATGTTTA
  • References

  • 15312768,10482513,20019076,17726680,17218307,11157946,28271471,28727759