SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


oxalate decarboxylase
43.41 kDa
protein length
385 aa Sequence Blast
gene length
1158 bp Sequence Blast
oxalate decarboxylase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.3|Acid stress proteins (controlled by YvrI-YvrHa)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    3,410,466 3,411,623

    The protein

    Catalyzed reaction/ biological activity

  • Oxalate --> formate + CO2 (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|1568DD457FDD482B3C14954A95F62BE338CBD15D|OxdD]
  • Modification

  • phosphorylated on Arg-12 [Pubmed|22517742]
  • [SW|Cofactors]

  • requires two Mn(II) centers for activity [Pubmed|24444454,19473032]
  • Structure

  • [PDB|1L3J] [pubmed|14871895]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO]: sigma factor, [Pubmed|19047353], in [regulon|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO regulon]
  • [protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA]: sigma factor, in [regulon|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA regulon]
  • regulation

  • induced by acidic growth conditions [Pubmed|19047353]
  • view in new tab

    Biological materials


  • MGNA-B053 (yvrK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33240 ([gene|9793E952C985BA268AC28C907900A03F4E8A3253|oxdC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATGTTTCCTCCTTA, downstream forward: _UP4_TAAAAGACTTGCGGCTTGCA
  • BKK33240 ([gene|9793E952C985BA268AC28C907900A03F4E8A3253|oxdC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATGTTTCCTCCTTA, downstream forward: _UP4_TAAAAGACTTGCGGCTTGCA
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References


  • 20464388
  • Original publications

  • 12056897,18573182,17269748,14871895,10960116,19047353,19473032,11546787,15583401,21264418,21782782,22404040,23734819,25526893,21277974,22517742,24444454,25186982,26641915,26744902,27797181,14871895,29620872,30806021