SubtiBank SubtiBank
oxdC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

oxdC

oxalate decarboxylase
locus
BSU_33240
pI
5.10
mw
43.41 kDa
protein length
385 aa Sequence Blast
gene length
1158 bp Sequence Blast
function
unknown
product
oxalate decarboxylase
essential
no
ec
4.1.1.2
synonyms
yvrK

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.3|Acid stress proteins (controlled by YvrI-YvrHa)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,410,466 3,411,623

    The protein

    Catalyzed reaction/ biological activity

  • H+ + oxalate --> CO2 + formate (according to UniProt)
  • Paralogous protein(s)

  • [protein|1568DD457FDD482B3C14954A95F62BE338CBD15D|OxdD]
  • Modification

  • phosphorylated on Arg-12 [Pubmed|22517742]
  • [SW|Cofactors]

  • requires two Mn(II) centers for activity [Pubmed|24444454,19473032]
  • Structure

  • [PDB|1L3J] [pubmed|14871895]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|9793E952C985BA268AC28C907900A03F4E8A3253|oxdC]-[gene|07C35D58F6AF97F8E6BB75CF8E8B811BAFAB201B|rsiO]
    description
    [Pubmed|19047353]

    sigma factors

  • [protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO]: sigma factor, [Pubmed|19047353], in [regulon|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO regulon]
  • [protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA]: sigma factor, in [regulon|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA regulon]
  • regulation

  • induced by acidic growth conditions [Pubmed|19047353]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B053 (yvrK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1052 NBRP B. subtilis, Japan]
  • BKE33240 ([gene|9793E952C985BA268AC28C907900A03F4E8A3253|oxdC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATGTTTCCTCCTTA, downstream forward: _UP4_TAAAAGACTTGCGGCTTGCA
  • BKK33240 ([gene|9793E952C985BA268AC28C907900A03F4E8A3253|oxdC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATGTTTCCTCCTTA, downstream forward: _UP4_TAAAAGACTTGCGGCTTGCA
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

    Reviews

  • 20464388
  • Original publications

  • 12056897,18573182,17269748,14871895,10960116,19047353,19473032,11546787,15583401,21264418,21782782,22404040,23734819,25526893,21277974,22517742,24444454,25186982,26641915,26744902,27797181,14871895,29620872,30806021