SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


S protein of tryptophan [SW|ECF transporter]
18.13 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
tryptophan uptake
S protein of tryptophan [SW|ECF transporter]

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter] → [category|SW|The substrate-specific S components of the ECF transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aromatic amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,074,646 1,075,164

    The protein

    Protein family

  • vitamin uptake transporter (VUT/ECF) (TC 2.A.88) family (with [protein|9685A380F95F1A73A693B53E4D35A1CB51043FEC|ThiT] and [protein|7DD4BB8222B2EFE81C32C5521A29256095B9D6C1|YpdP], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10735881], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • induced in the absence of tryptophan ([protein|search|MtrB]) [Pubmed|10735881]
  • view in new tab

    view in new tab

    Other regulations

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: translation inhibition, at an [SW|RNA switch], the [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB] binding site overlaps the Shine-DAlgarno sequence and translation initation region, [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB] binds in the presence of tryptophan [Pubmed|10735881]
  • Biological materials


  • MGNA-A686 (yhaG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10010 ([gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACTATGCTCTCCTCTG, downstream forward: _UP4_TAATTGTCACACAAAACCTC
  • BKK10010 ([gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACTATGCTCTCCTCTG, downstream forward: _UP4_TAATTGTCACACAAAACCTC
  • References


  • 20497229,22574898,24362466
  • Original publications

  • 10735881,14702295