SubtiBank SubtiBank
trpP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

trpP

S protein of tryptophan [SW|ECF transporter]
locus
BSU10010
pI
11.15
mw
18.13 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
function
tryptophan uptake
product
S protein of tryptophan [SW|ECF transporter]
essential
no
synonyms
yhaG

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter] → [category|SW 1.2.3.2|The substrate-specific S components of the ECF transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,074,646 1,075,164

    The protein

    Protein family

  • trpP transporter family (according to Swiss-Prot)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]
    description
    [Pubmed|10735881]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10735881], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • induced in the absence of tryptophan ([protein|search|MtrB]) [Pubmed|10735881]
  • view in new tab

    genes
    [gene|E7ED2FB756B47A0F2C73E42E4168D16F20BD7B1B|serC]-[gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]
    description
    [Pubmed|22383849]
    view in new tab

    Other regulations

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: translation inhibition, at an [SW|RNA switch], the [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB] binding site overlaps the Shine-DAlgarno sequence and translation initation region, [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB] binds in the presence of tryptophan [Pubmed|10735881]
  • Biological materials

    Mutant

  • MGNA-A686 (yhaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/686 NBRP B. subtilis, Japan]
  • BKE10010 ([gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACTATGCTCTCCTCTG, downstream forward: _UP4_TAATTGTCACACAAAACCTC
  • BKK10010 ([gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACTATGCTCTCCTCTG, downstream forward: _UP4_TAATTGTCACACAAAACCTC
  • References

    Reviews

  • 20497229,22574898,24362466
  • Original publications

  • 10735881,14702295