SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


fructose-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIABC of the [category|SW 1.2.2|PTS]
67.01 kDa
protein length
635 aa Sequence Blast
gene length
1908 bp Sequence Blast
fructose uptake and phosphorylation
fructose-specific [category|SW 1.2.2|PTS], EIIABC

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of fructose]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    1,509,256 1,511,163

    The protein

    Catalyzed reaction/ biological activity

  • D-fructose + Nπ-phospho-L-histidyl-[protein] --> D-fructose 1-phosphate + L-histidyl-[protein] (according to UniProt)
  • Protein family

  • [category|SW 1.2.2|PTS] permease, fructose/ mannitol family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|575CEC5C5C0458DC86A74F24654AC6990CB1E732|ManP]
  • [SW|Domains]

  • [SW|PTS EIIA domain] type-2 (aa 5-149) (according to UniProt)
  • [SW|PTS EIIB domain] type-2 (aa 172-267) (according to UniProt)
  • [SW|PTS EIIC domain] type-2 (aa 301-635) (according to UniProt)
  • Structure

  • [PDB|2R4Q] (EIIB domain)
  • [SW|Localization]

  • cell membrane (homogeneous) [Pubmed|16479537]
  • Expression and Regulation



    regulatory mechanism

  • [protein|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|FruR]: repression, (according to [ DBTBS]), in [regulon|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|FruR regulon]
  • regulation

  • induced in the presence of fructose ([protein|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|FruR]) (according to [ DBTBS])
  • view in new tab

    Biological materials


  • BKE14400 ([gene|973C3D3FBFDCA095A760C5F49A96D8BE48771014|fruA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTTTCACTTGTGTTTCCT, downstream forward: _UP4_TAAGAAAAAAAGCGTCCTTG
  • BKK14400 ([gene|973C3D3FBFDCA095A760C5F49A96D8BE48771014|fruA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTTTCACTTGTGTTTCCT, downstream forward: _UP4_TAAGAAAAAAAGCGTCCTTG
  • References

  • 16479537,10627040,21630458