SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


chorismate synthase
40.04 kDa
protein length
390 aa Sequence Blast
gene length
1173 bp Sequence Blast
biosynthesis of aromatic amino acids
chorismate synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aromatic amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,379,100 2,380,272

    Phenotypes of a mutant

  • essential [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • 5-O-(1-carboxyvinyl)-3-phosphoshikimate --> chorismate + phosphate (according to UniProt)
  • Protein family

  • chorismate synthase family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-127 [Pubmed|22517742]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|2O11] (from ''Mycobacterium tuberculosis h37rv mutant'', 42% identity, 58% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • BKE22710 ([gene|9712D0E655289C97315314BDEE1A0DF2ED2ADCA2|aroF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTTCTTCTCCCTTCA, downstream forward: _UP4_AGAAAACTGTCGAGGGAATT
  • References


  • 12966138
  • Original publications

  • 4202998,22517742,28189581,21815947