SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


chorismate synthase
40.04 kDa
protein length
390 aa Sequence Blast
gene length
1173 bp Sequence Blast
biosynthesis of aromatic amino acids
chorismate synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aromatic amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,379,100 2,380,272

    Phenotypes of a mutant

  • essential [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • 5-O-(1-carboxyvinyl)-3-phosphoshikimate = chorismate + phosphate (according to Swiss-Prot)
  • Protein family

  • chorismate synthase family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-127 [Pubmed|22517742]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|2O11] (from ''Mycobacterium tuberculosis h37rv mutant'', 42% identity, 58% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • BKE22710 ([gene|9712D0E655289C97315314BDEE1A0DF2ED2ADCA2|aroF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTTCTTCTCCCTTCA, downstream forward: _UP4_AGAAAACTGTCGAGGGAATT
  • References


  • 12966138
  • Original publications

  • 4202998,22517742,28189581,21815947