SubtiBank SubtiBank
aroF
The papers of the month are back! Check them out! Link here

aroF

chorismate synthase
locus
BSU22710
pI
6.58
mw
40.04 kDa
protein length
369 aa Sequence Blast
gene length
1107 bp Sequence Blast
function
biosynthesis of aromatic amino acids
product
chorismate synthase
essential
yes
ec
4.2.3.5
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,379,100 → 2,380,272

    Phenotypes of a mutant

  • essential [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • 5-O-(1-carboxyvinyl)-3-phosphoshikimate = chorismate + phosphate (according to Swiss-Prot)
  • Protein family

  • acetokinase family (according to Swiss-Prot)
  • Modification

  • phosphorylated on Arg-127 [Pubmed|22517742]
  • Structure

  • [PDB|2O11] (from ''Mycobacterium tuberculosis h37rv mutant'', 42% identity, 58% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|9712D0E655289C97315314BDEE1A0DF2ED2ADCA2|aroF]-[gene|58B782C1F7931F8671161455E65E3D5C72B0BB9C|aroB]-[gene|5C2F7F9F5FCBFEDF77AC41725EFDA0FAF0FC3BC1|aroH]
    description
    [pubmed|21815947]
    view in new tab

    Biological materials

    Mutant

  • BKE22710 (Δ[gene|9712D0E655289C97315314BDEE1A0DF2ED2ADCA2|aroF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTTCTTCTCCCTTCA, downstream forward: _UP4_AGAAAACTGTCGAGGGAATT
  • References

    Reviews

  • 12966138
  • Original publications

  • 4202998,22517742,28189581,21815947