SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component sensor kinase of the YvrG-YvrHb two-component system
66.58 kDa
protein length
580 aa Sequence Blast
gene length
1743 bp Sequence Blast
regulation cell surface maintenance
two-component sensor histidine kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    3,406,614 3,408,356

    Phenotypes of a mutant

  • unusual autolysis and higher susceptibility to cell envelope antibiotics (bacitracin, aztreonam, cefepime, fosfomycin) [Pubmed|16306698]
  • The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of the [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb] response regulator [Pubmed|16306698]
  • Paralogous protein(s)

  • [protein|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|YkoH], [protein|1582E81F7DA85F38D6732D341ABD0F052587F25A|KinE], [protein|4EE48E4931F662E51586DB6D01E91C688329222D|CssS], [protein|52BB660B0CAB36C74F1D47963235846B45AF78AB|YclK]
  • [SW|Domains]

  • two transmembrane segments, C-terminal histidine phosphotransferase domain
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B049 (yvrG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33210 ([gene|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|yvrG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTCATGACCGCTTGCCTTC, downstream forward: _UP4_TAAACATCAAGTGGTTTGGA
  • BKK33210 ([gene|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|yvrG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTCATGACCGCTTGCCTTC, downstream forward: _UP4_TAAACATCAAGTGGTTTGGA
  • References

  • 10094672,18820022,16306698