SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to alkaline phosphatase
24.79 kDa
protein length
221 aa Sequence Blast
gene length
666 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    1,409,912 1,410,577

    The protein

    Protein family

  • dedA family (with [protein|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|YbfM] and [protein|289828D37CF5422908316ED2EF1AEAE76F84161D|YngC], according to UniProt)
  • Paralogous protein(s)

  • [protein|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|YbfM]:
  • [protein|289828D37CF5422908316ED2EF1AEAE76F84161D|YngC]:
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE13430 ([gene|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|ykoX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATTTTTCTCTTTTCG, downstream forward: _UP4_TGACAAATCACTGCGCTGCG
  • BKK13430 ([gene|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|ykoX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATTTTTCTCTTTTCG, downstream forward: _UP4_TGACAAATCACTGCGCTGCG
  • GP2755 ([gene|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|ykoX]::''spc''), available in [SW|Jörg Stülke]'s lab