SubtiBank SubtiBank
ykoX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykoX

similar to alkaline phosphatase
locus
BSU_13430
pI
10.04
mw
24.79 kDa
protein length
221 aa Sequence Blast
gene length
666 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,409,912 1,410,577

    The protein

    Protein family

  • dedA family (with [protein|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|YbfM] and [protein|289828D37CF5422908316ED2EF1AEAE76F84161D|YngC], according to UniProt)
  • Paralogous protein(s)

  • [protein|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|YbfM]:
  • [protein|289828D37CF5422908316ED2EF1AEAE76F84161D|YngC]:
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|ykoX]-[gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|ykoY]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE13430 ([gene|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|ykoX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATTTTTCTCTTTTCG, downstream forward: _UP4_TGACAAATCACTGCGCTGCG
  • BKK13430 ([gene|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|ykoX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATTTTTCTCTTTTCG, downstream forward: _UP4_TGACAAATCACTGCGCTGCG
  • GP2755 ([gene|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|ykoX]::''spc''), available in [SW|Jörg Stülke]'s lab