SubtiBank SubtiBank
pbuE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pbuE

putative hypoxanthine exporter
locus
BSU_05800
pI
8.88
mw
41.38 kDa
protein length
388 aa Sequence Blast
gene length
1167 bp Sequence Blast
function
nucleotide metabolism
product
putative hypoxanthine exporter
essential
no
synonyms
ydhL

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.6|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.4|Nucleotide metabolism/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    625,125 626,291

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • DHA1 family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|96B48D9B984010FECD2C194D7CF3CADFC22F2AA7|pbuE]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [regulon|a-box|a-box]: termination/antitermination, adenine-controlled, in [regulon|a-box|a-box]
  • regulation

  • induced by hypoxanthine and guanine, [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]-independent [Pubmed|12923093]
  • induced by adenine ([regulon|A-box|A-box]) [Pubmed|14718920]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C187 (ydhL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2185 NBRP B. subtilis, Japan]
  • BKE05800 ([gene|96B48D9B984010FECD2C194D7CF3CADFC22F2AA7|pbuE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAACTCCTTTACTT, downstream forward: _UP4_TCCTTGTAAAAGGAGGATTT
  • BKK05800 ([gene|96B48D9B984010FECD2C194D7CF3CADFC22F2AA7|pbuE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAAACTCCTTTACTT, downstream forward: _UP4_TCCTTGTAAAAGGAGGATTT
  • References

  • 25550163,15629952,14718920,12923093,12923093,18441052,17935948,17853814,16931335,16201765,20022916,12787499,21283784,25573585