SubtiBank SubtiBank
yknZ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yknZ

[SW|ABC transporter] (permease) for the export of the [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC] toxin
locus
BSU_14370
pI
4.68
mw
41.96 kDa
protein length
397 aa Sequence Blast
gene length
1194 bp Sequence Blast
function
resistence against [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC] toxin
product
[SW|ABC transporter] (permease)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.3|Export of peptides]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,506,105 1,507,298

    The protein

    Protein family

  • [SW|ABC-4 integral membrane protein family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|5AEDC5B857537B7D2A2637C0BC5BE78FD09A66B3|YvrN]
  • Structure

  • [PDB|5WS4] (from Acinetobacter baumanni, 38% identity) [pubmed|29109439]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|70D7098BEBD5E53B4B9B8C3394FAAF972C65EE22|yknU]-[gene|C6B0ACB9D9703DD8141FD7D9D62DB22FB48F458B|yknV]-[gene|916419C4ED113778488EBC558A35810498028B02|yknW]-[gene|FD270195901B89DAAAD134DB9DE729670A9BDECF|yknX]-[gene|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY]-[gene|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|916419C4ED113778488EBC558A35810498028B02|yknW]-[gene|FD270195901B89DAAAD134DB9DE729670A9BDECF|yknX]-[gene|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|yknY]-[gene|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12076816], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logrithmic growth ([protein|search|AbrB]) [Pubmed|12076816]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B351 (yknZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1350 NBRP B. subtilis, Japan]
  • BKE14370 ([gene|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGATGTTTTCCAACA, downstream forward: _UP4_TAGCCTCATGCAACATGCAT
  • BKK14370 ([gene|9680326BAA94A503E2A5C6F0A2479AE0B0467B4C|yknZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGATGTTTTCCAACA, downstream forward: _UP4_TAGCCTCATGCAACATGCAT
  • References

  • 10092453,16629676,9987136,12076816,29109439