SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


class III heat-shock protein (molecular chaperone)
72.08 kDa
protein length
626 aa Sequence Blast
gene length
1881 bp Sequence Blast
class III heat-shock protein (molecular chaperone)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.2|Chaperones/ protein folding]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    4,089,429 4,091,309

    The protein

    Protein family

  • heat shock protein 90 family (single member, according to UniProt)
  • Structure

  • [PDB|2IOQ] (from ''Escherichia coli'', 39% identity, 61% similarity) [Pubmed|17055434]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9150201], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • induced by high temperature [Pubmed|9150201]
  • view in new tab

    Biological materials


  • GP1159 (del cat) available in [SW|Jörg Stülke]'s lab
  • BKE39820 ([gene|962A955DED82EC0197757206A706796EC8F768BD|htpG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCTTGATCGCTCCTTTA, downstream forward: _UP4_TAAACAGAAAAAGGAATCGT
  • BKK39820 ([gene|962A955DED82EC0197757206A706796EC8F768BD|htpG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCTTGATCGCTCCTTTA, downstream forward: _UP4_TAAACAGAAAAAGGAATCGT
  • References

  • 9150201,12511492,10323241