SubtiBank SubtiBank
yonT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yonT

toxin
locus
BSU_21000
pI
12.86
mw
6.78 kDa
protein length
gene length
177 bp Sequence Blast
function
unknown
product
toxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.1|Type 1 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.9|NcRNA] → [category|SW 6.9.6|Antisense RNAs of toxin/antitoxin systems]
  • Gene

    Coordinates
    2,219,784 2,219,960

    RNA

    additional information

  • [gene|search|yonT ]mRNA half-life: 8 min [pubmed|29414903]
  • Expression and Regulation

    Operons

    genes
    [gene|961DB64225CEF84D80982ADBDC9BBBCDF5049132|yonT]-[gene|A01986F131F973AFE08CC28E89CB70FD2BED06EE|yoyJ]-[gene|21DF0BF609522F9FFF636A9AF99779A459166A8D|yonU]-[gene|ED02B21A2296C6A5A19007810D0416FCBAF5B9ED|yonV]
    description
    [Pubmed|29414903]
    view in new tab

    genes
    [gene|961DB64225CEF84D80982ADBDC9BBBCDF5049132|yonT]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|8832F99BF927D5A4D6CB265DB24D3AE46434A5CD|SR6]: antisense RNA, in [regulon|8832F99BF927D5A4D6CB265DB24D3AE46434A5CD|SR6 regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE21000 ([gene|961DB64225CEF84D80982ADBDC9BBBCDF5049132|yonT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATGTACACCTCCTTTC, downstream forward: _UP4_TGAGAGCTAAGCTAAAGGGG
  • BKK21000 ([gene|961DB64225CEF84D80982ADBDC9BBBCDF5049132|yonT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATGTACACCTCCTTTC, downstream forward: _UP4_TGAGAGCTAAGCTAAAGGGG
  • References

    Reviews

  • 23300472,31075979,32850966
  • Original publications

  • 20156992,19210617,23300471,29414903