SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


6.78 kDa
protein length
gene length
177 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW|Type 1 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.9|NcRNA] → [category|SW 6.9.6|Antisense RNAs of toxin/antitoxin systems]
  • Gene

    2,219,784 2,219,960


    additional information

  • [gene|search|yonT ]mRNA half-life: 8 min [pubmed|29414903]
  • Expression and Regulation


    view in new tab


    regulatory mechanism

  • [protein|8832F99BF927D5A4D6CB265DB24D3AE46434A5CD|SR6]: antisense RNA, in [regulon|8832F99BF927D5A4D6CB265DB24D3AE46434A5CD|SR6 regulon]
  • view in new tab

    Biological materials


  • BKE21000 ([gene|961DB64225CEF84D80982ADBDC9BBBCDF5049132|yonT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATGTACACCTCCTTTC, downstream forward: _UP4_TGAGAGCTAAGCTAAAGGGG
  • BKK21000 ([gene|961DB64225CEF84D80982ADBDC9BBBCDF5049132|yonT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATGTACACCTCCTTTC, downstream forward: _UP4_TGAGAGCTAAGCTAAAGGGG
  • References


  • 23300472,31075979
  • Original publications

  • 20156992,19210617,23300471,29414903