SubtiBank SubtiBank
ydaM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydaM

general stress protein, synthesis of extracellular polysaccharide
locus
BSU_04300
pI
9.73
mw
49.61 kDa
protein length
420 aa Sequence Blast
gene length
1263 bp Sequence Blast
function
synthesis of extracellular polysaccharide
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    482,577 483,839

    The protein

    Protein family

  • [SW|glycosyltransferase 2 family] [Pubmed|27897378]
  • [SW|Localization]

  • cell membrane, forms clusters at the cell poles and septa (with [protein|70ED3CE683F3A3F785480F40986CABE7729C17C7|YdaK] and [protein|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|YdaN]) [Pubmed|27897378]
  • Expression and Regulation

    Operons

    genes
    [gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|22383849], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • expressed during stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C076 (ydaM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2074 NBRP B. subtilis, Japan]
  • JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
  • BKE04300 ([gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTTAGCGAGATAAAGAACA, downstream forward: _UP4_CAACATAAAAGCGGGTGACC
  • BKK04300 ([gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTTAGCGAGATAAAGAACA, downstream forward: _UP4_CAACATAAAAGCGGGTGACC
  • References

    Reviews

  • 28296273
  • Original publications

  • 22383849,27897378