SubtiBank SubtiBank
thiS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

thiS

sulfur carrier protein, hydroxyethylthiazole phosphate biosynthesis
locus
BSU_11680
pI
5.50
mw
7.49 kDa
protein length
gene length
201 bp Sequence Blast
function
biosynthesis of thiamine
product
sulfur carrier protein
essential
no
synonyms
yjbS

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.3|Biosynthesis/ acquisition of thiamine]
  • Gene

    Coordinates
    1,244,844 1,245,044

    The protein

    Protein family

  • sulfur carrier protein ThiS family (single member, according to UniProt)
  • Structure

  • [PDB|1TYG] (complex with [protein|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|ThiG]) [Pubmed|15362849]
  • Expression and Regulation

    Operons

    genes
    [gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]-[gene|CA6AAE8AC5B5EF01A911B035F8782579CD876C08|tenI]-[gene|87B5C84B7EE10F60B545CCFEF6A527A546B80432|thiO]-[gene|95DA3F899037140F48B99E065C768356CE08FA94|thiS]-[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]-[gene|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|thiF]-[gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]
    description
    [Pubmed|1898926]

    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [SW|RNA switch], via [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([SW|Thi-box]) [Pubmed|16356850]
  • the [SW|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE11680 ([gene|95DA3F899037140F48B99E065C768356CE08FA94|thiS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTTTACCGTTCAGCTGTA, downstream forward: _UP4_ATTGTCCATTTTGTAGGAGG
  • BKK11680 ([gene|95DA3F899037140F48B99E065C768356CE08FA94|thiS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTTTACCGTTCAGCTGTA, downstream forward: _UP4_ATTGTCCATTTTGTAGGAGG
  • References

    Reviews

  • 19348578,10382260
  • Original publications

  • 15362849,14567704