SubtiBank SubtiBank
yjdI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjdI

similiar to Cys-tRNA(Pro) and Cys-tRNA(Cys) deacylase
locus
BSU_12060
pI
8.76
mw
17.12 kDa
protein length
159 aa Sequence Blast
gene length
480 bp Sequence Blast
function
maturation of tRNA
product
Cys-tRNA(Pro) and Cys-tRNA(Cys) deacylase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.9|tRNA modification and maturation/ based on similarity]
  • Gene

    Coordinates
    1,277,686 1,278,165

    The protein

    Protein family

  • prolyl-tRNA editing family (single member, according to UniProt)
  • Structure

  • [PDB|2DXA] (from E. coli, 44% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|95AAF457B155A56DBD63D0AAB7C986AFBEC5ADEF|yjdI]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A257 (yjdI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/257 NBRP B. subtilis, Japan]
  • BKE12060 ([gene|95AAF457B155A56DBD63D0AAB7C986AFBEC5ADEF|yjdI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTTCACCCACTATC, downstream forward: _UP4_TAGATGCAGATATAGGGGAA
  • BKK12060 ([gene|95AAF457B155A56DBD63D0AAB7C986AFBEC5ADEF|yjdI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTTCACCCACTATC, downstream forward: _UP4_TAGATGCAGATATAGGGGAA
  • References

  • 15886196,14530268,16087664,24371276