SubtiBank SubtiBank
yqeH
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

yqeH

assembly/ stability of the 30S subunit of the ribosome, assembly of the 70S ribosome
locus
BSU25670
pI
6.01
mw
40.84 kDa
protein length
366 aa Sequence Blast
gene length
1098 bp Sequence Blast
function
ribosome assembly
product
GTPase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.6|Ribosome assembly]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.3|GTP-binding proteins]
  • Gene

    Coordinates
    2,645,490 → 2,646,590

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • Binds and hydrolyzes GTP and readily exchanges GDP for GTP
  • Protein family

  • Era/Obg family
  • Paralogous protein(s)

  • [protein|CB68B3393CA7862C45C624AF7B1ADD188243A01F|Era], [protein|84E7D672DB40B114DC4D96A4D8834958B47401A7|Obg], [protein|B2270316642C66BC2DA86EBDCD1BF6A33CC6A1DC|YphC], [protein|DF1A043F3D9817D9479B8C707F4ACEEF2BF2862C|YsxC], [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA], [protein|66A6EC4F6CB91EE741BB9D7646913FF3EE602BD7|ThdF], [protein|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|YyaF], [protein|9F6B78C1932FB56F7F71430DB16BC862A312407B|YnbA]
  • Structure

  • [PDB|3EC1] (Geobacillus stearothermophilus) [pubmed|18801747]
  • Expression and Regulation

    Operons

    genes
    [gene|722FD63050EED803C859FFD61338C02D5BB4CC1C|yqeG]-[gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]-[gene|776D79C45DADA631D4A75B0773CFF471A87D9EEC|aroD]-[gene|7774FC36BAEAD33EDD48CB77DA0B5E7E0EA38CA2|yqeI]-[gene|AA4BB1F5B58371D536A6BBA86F6ECB5E5BFB12A8|nadD]-[gene|247C47AC70A0EA53E625871D9BC463A06E6B05FB|yqeK]-[gene|B9D5E9B566D28423232C1A28C966CDEA0E5A6B78|yqeL]-[gene|7F63251ABC07F6C11C57B62CBB948240B08D0181|yqeM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE25670 (Δ[gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTACTCCTCCCACT, downstream forward: _UP4_ATTTAAGAAAAGGGGAGAGG
  • BKK25670 (Δ[gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTACTCCTCCCACT, downstream forward: _UP4_ATTTAAGAAAAGGGGAGAGG
  • Labs working on this gene/protein

  • [SW|Naotake Ogasawara], Nara, Japan
  • References

    Reviews

  • 19575570,21885683
  • Original publications

  • 12427945,20376346,19540197,17895579,17237168,22383849,28189581,18801747