SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


assembly/ stability of the 30S subunit of the ribosome, assembly of the 70S ribosome
40.84 kDa
protein length
366 aa Sequence Blast
gene length
1098 bp Sequence Blast
ribosome assembly

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Ribosome assembly]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.3|GTP-binding proteins]
  • Gene

    2,645,490 → 2,646,590

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • Binds and hydrolyzes GTP and readily exchanges GDP for GTP
  • Protein family

  • Era/Obg family
  • Paralogous protein(s)

  • [protein|9F6B78C1932FB56F7F71430DB16BC862A312407B|YnbA], [protein|B2270316642C66BC2DA86EBDCD1BF6A33CC6A1DC|YphC], [protein|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|YyaF], [protein|CB68B3393CA7862C45C624AF7B1ADD188243A01F|Era], [protein|DF1A043F3D9817D9479B8C707F4ACEEF2BF2862C|YsxC], [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA], [protein|66A6EC4F6CB91EE741BB9D7646913FF3EE602BD7|ThdF], [protein|84E7D672DB40B114DC4D96A4D8834958B47401A7|Obg]
  • Structure

  • [PDB|3EC1] (Geobacillus stearothermophilus) [pubmed|18801747]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE25670 (Δ[gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTACTCCTCCCACT, downstream forward: _UP4_ATTTAAGAAAAGGGGAGAGG
  • BKK25670 (Δ[gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTACTCCTCCCACT, downstream forward: _UP4_ATTTAAGAAAAGGGGAGAGG
  • Labs working on this gene/protein

  • [SW|Naotake Ogasawara], Nara, Japan
  • References


  • 19575570,21885683
  • Original publications

  • 12427945,20376346,19540197,17895579,17237168,22383849,28189581,18801747