SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


assembly/ stability of the 30S subunit of the ribosome, assembly of the 70S ribosome
40.84 kDa
protein length
366 aa Sequence Blast
gene length
1101 bp Sequence Blast
ribosome assembly

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Ribosome assembly]
  • [category|SW 6|Groups of genes] → [category|SW 6.3|GTP-binding proteins]
  • Gene

    2,645,490 2,646,590

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • defective in 16S rRNA 3' processing by [protein|E0437C86E5F3707FF1DA13C8B98F73130DED8FB4|YqfG] [pubmed|31003868]
  • The protein

    Catalyzed reaction/ biological activity

  • Binds and hydrolyzes GTP and readily exchanges GDP for GTP
  • Protein family

  • TRAFAC class YlqF/YawG GTPase family (together with [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA] and [protein|519D4694B2895EE6F0D38D918F52F27734506848|CpgA], according to UniProt)
  • Paralogous protein(s)

  • [protein|9F6B78C1932FB56F7F71430DB16BC862A312407B|YnbA], [protein|B2270316642C66BC2DA86EBDCD1BF6A33CC6A1DC|YphC], [protein|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|YyaF], [protein|CB68B3393CA7862C45C624AF7B1ADD188243A01F|Era], [protein|DF1A043F3D9817D9479B8C707F4ACEEF2BF2862C|YsxC], [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA], [protein|66A6EC4F6CB91EE741BB9D7646913FF3EE602BD7|ThdF], [protein|84E7D672DB40B114DC4D96A4D8834958B47401A7|Obg]
  • [SW|Domains]

  • CP-type G domain (aa 59-222) (according to UniProt)
  • Structure

  • [PDB|3EC1] (Geobacillus stearothermophilus) [pubmed|18801747]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE25670 ([gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTACTCCTCCCACT, downstream forward: _UP4_ATTTAAGAAAAGGGGAGAGG
  • BKK25670 ([gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTACTCCTCCCACT, downstream forward: _UP4_ATTTAAGAAAAGGGGAGAGG
  • labs

  • [SW|Naotake Ogasawara], Nara, Japan
  • References


  • 19575570,21885683
  • Original publications

  • 12427945,20376346,19540197,17895579,17237168,22383849,28189581,18801747,31003868