SubtiBank SubtiBank
yqeH
The papers of the month are back! Check them out! Link here

yqeH

assembly/ stability of the 30S subunit of the ribosome, assembly of the 70S ribosome
locus
BSU25670
pI
6.01
mw
40.84 kDa
protein length
366 aa Sequence Blast
gene length
1098 bp Sequence Blast
function
ribosome assembly
product
GTPase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.6|Ribosome assembly]
  • [category|SW 6|Groups of genes] → [category|SW 6.3|GTP-binding proteins]
  • Gene

    Coordinates
    2,645,490 → 2,646,590

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • Binds and hydrolyzes GTP and readily exchanges GDP for GTP
  • Protein family

  • Era/Obg family
  • Paralogous protein(s)

  • [protein|9F6B78C1932FB56F7F71430DB16BC862A312407B|YnbA], [protein|B2270316642C66BC2DA86EBDCD1BF6A33CC6A1DC|YphC], [protein|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|YyaF], [protein|CB68B3393CA7862C45C624AF7B1ADD188243A01F|Era], [protein|DF1A043F3D9817D9479B8C707F4ACEEF2BF2862C|YsxC], [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA], [protein|66A6EC4F6CB91EE741BB9D7646913FF3EE602BD7|ThdF], [protein|84E7D672DB40B114DC4D96A4D8834958B47401A7|Obg]
  • Structure

  • [PDB|3EC1] (Geobacillus stearothermophilus) [pubmed|18801747]
  • Expression and Regulation

    Operons

    genes
    [gene|722FD63050EED803C859FFD61338C02D5BB4CC1C|yqeG]-[gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]-[gene|776D79C45DADA631D4A75B0773CFF471A87D9EEC|aroD]-[gene|7774FC36BAEAD33EDD48CB77DA0B5E7E0EA38CA2|yqeI]-[gene|AA4BB1F5B58371D536A6BBA86F6ECB5E5BFB12A8|nadD]-[gene|247C47AC70A0EA53E625871D9BC463A06E6B05FB|yqeK]-[gene|B9D5E9B566D28423232C1A28C966CDEA0E5A6B78|yqeL]-[gene|7F63251ABC07F6C11C57B62CBB948240B08D0181|yqeM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE25670 (Δ[gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTACTCCTCCCACT, downstream forward: _UP4_ATTTAAGAAAAGGGGAGAGG
  • BKK25670 (Δ[gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTACTCCTCCCACT, downstream forward: _UP4_ATTTAAGAAAAGGGGAGAGG
  • labs

  • [SW|Naotake Ogasawara], Nara, Japan
  • References

    Reviews

  • 19575570,21885683
  • Original publications

  • 12427945,20376346,19540197,17895579,17237168,22383849,28189581,18801747