SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to esterase
28.91 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,191,423 1,192,190

    The protein


  • [PDB|1UFO] (from ''Thermus thermophilus'', 26% identity) [Pubmed|15648092]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B197 (yitV::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11150 ([gene|9592D944FE0863A3099E396D9A96F60E61D6C01C|yitV]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATGTGCCCCTCCTTAG, downstream forward: _UP4_TAAAGCACTAAGTTATTAAC
  • BKK11150 ([gene|9592D944FE0863A3099E396D9A96F60E61D6C01C|yitV]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATGTGCCCCTCCTTAG, downstream forward: _UP4_TAAAGCACTAAGTTATTAAC
  • References

  • 26820469,15648092