SubtiBank SubtiBank
yitV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yitV

similar to esterase
locus
BSU_11150
pI
5.56
mw
28.91 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,191,423 1,192,190

    The protein

    Structure

  • [PDB|1UFO] (from ''Thermus thermophilus'', 26% identity) [Pubmed|15648092]
  • Expression and Regulation

    Operons

    genes
    [gene|9592D944FE0863A3099E396D9A96F60E61D6C01C|yitV]-[gene|DB374B763EE496FA5F0904686384D94170CE47E3|yitW]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B197 (yitV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1196 NBRP B. subtilis, Japan]
  • BKE11150 ([gene|9592D944FE0863A3099E396D9A96F60E61D6C01C|yitV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATGTGCCCCTCCTTAG, downstream forward: _UP4_TAAAGCACTAAGTTATTAAC
  • BKK11150 ([gene|9592D944FE0863A3099E396D9A96F60E61D6C01C|yitV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATGTGCCCCTCCTTAG, downstream forward: _UP4_TAAAGCACTAAGTTATTAAC
  • References

  • 26820469,15648092