SubtiBank SubtiBank
csbD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

csbD

general stress protein
locus
BSU_36670
pI
9.69
mw
6.66 kDa
protein length
gene length
189 bp Sequence Blast
function
survival of salt stress and at low temperatures
product
unknown
essential
no
synonyms
ywmG

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    3,770,104 3,770,292

    The protein

    Protein family

  • UPF0337 (CsbD) family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|958B606BFE4C3A3E1A48787A8F427CCCDCB65422|csbD]
    description
    [Pubmed|10376822]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10376822,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • ''csbD'': induced by stress ([protein|search|SigB]) [Pubmed|10376822,15805528]
  • view in new tab

    genes
    [gene|F775A9E74554ECBB7DD6F905FB95D67B848CBF21|ywmF]-[gene|958B606BFE4C3A3E1A48787A8F427CCCDCB65422|csbD]
    description
    [Pubmed|10376822]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • ''csbD'': induced by stress ([protein|search|SigB]) [Pubmed|10376822,15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A194 (ywmG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/194 NBRP B. subtilis, Japan]
  • BKE36670 ([gene|958B606BFE4C3A3E1A48787A8F427CCCDCB65422|csbD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTAATTCTCCCCTCTC, downstream forward: _UP4_TAATCGTACGGAAGAGGCAG
  • BKK36670 ([gene|958B606BFE4C3A3E1A48787A8F427CCCDCB65422|csbD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTAATTCTCCCCTCTC, downstream forward: _UP4_TAATCGTACGGAAGAGGCAG
  • References

  • 10376822,15805528