SubtiBank SubtiBank
pabA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pabA

para-aminobenzoate synthase (subunit B)/ anthranilate synthase (subunit II)
locus
BSU00750
pI
4.78
mw
21.54 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
function
biosynthesis of folate and tryptophan
product
para-aminobenzoate synthase (subunit B)/ anthranilate synthase (subunit II) glutamine amidotransferase (subunit B) and anthranilate synthase (subunit II)
essential
no
ec
2.6.1.85
synonyms
trpG,trpX

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.5|Biosynthesis of folate]
  • Gene

    Coordinates
    84,290 84,874

    The protein

    Catalyzed reaction/ biological activity

  • Chorismate + L-glutamine = anthranilate + pyruvate + L-glutamate (according to UniProt)
  • Structure

  • [PDB|1I1Q] (from ''Salmonella typhimurium'', 42% identity) [Pubmed|11224570]
  • Expression and Regulation

    Operons

    genes
    [gene|B189AD3E3D18876E1956763182D835A151727392|pabB]-[gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]-[gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC]-[gene|FA9539CB701BC47FD4E849FBA6D7B201B27C6104|sul]-[gene|AAE44B4F73C7C02F7DB3574B6169E0DE46F4B787|folB]-[gene|D2B189C6292ACE1B25658B407C284E9A683EAE5B|folK]-[gene|F373EBC35805DC551E8AFF6FDC7E43D5587C4700|yazB]-[gene|CE45D56BC413555AF4E7914B5307AD967A358452|yacF]-[gene|24CC89DE55B3C19F80B11D106B9FD241174AE3E4|lysS]
    description
    [Pubmed|9084182]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9084182], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • translation repressed by tryptophan ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|9084182]
  • view in new tab

    Other regulations

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: translation inhibition, [Pubmed|9084182]
  • additional information

  • the [gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]-[gene|865678B10097C40337F5EEA77FF0F6E7BF5358DC|pabC] part of the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • Biological materials

    Mutant

  • BKE00750 ([gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAATCATTTCTCCGC, downstream forward: _UP4_TATCGCAAGGAAGTTATTGC
  • BKK00750 ([gene|956E33AAAADB302EB8663E4B75C917242D3AD2C0|pabA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAATCATTTCTCCGC, downstream forward: _UP4_TATCGCAAGGAAGTTATTGC
  • References

    Reviews

  • 16285852,19385727
  • Original Publications

  • 8647825,7515880,9084182,17114263,21815947,11224570