SubtiBank SubtiBank
yclE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yclE

similar to prolyl aminopeptidase
locus
BSU_03660
pI
5.62
mw
32.56 kDa
protein length
281 aa Sequence Blast
gene length
846 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    415,350 416,195

    The protein

    Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|AB hydrolase-1 domain] (aa 30-268) (according to UniProt)
  • Structure

  • [PDB|1QTR] (from Serratia marcescens, 23% identity) [pubmed|10467172]
  • Expression and Regulation

    Operons

    genes
    [gene|955CEAE1FBBABFD683FABB60CF74554AF12019B2|yclE]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C063 (yclE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2061 NBRP B. subtilis, Japan]
  • BKE03660 ([gene|955CEAE1FBBABFD683FABB60CF74554AF12019B2|yclE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTCACGCCCCCTTTT, downstream forward: _UP4_TAAAAAACAGCCCGCAGATC
  • BKK03660 ([gene|955CEAE1FBBABFD683FABB60CF74554AF12019B2|yclE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTCACGCCCCCTTTT, downstream forward: _UP4_TAAAAAACAGCCCGCAGATC
  • References

    Research papers

  • 10467172