SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to prolyl aminopeptidase
32.56 kDa
protein length
281 aa Sequence Blast
gene length
846 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    415,350 416,195

    The protein

    Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|AB hydrolase-1 domain] (aa 30-268) (according to UniProt)
  • Structure

  • [PDB|1QTR] (from Serratia marcescens, 23% identity) [pubmed|10467172]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C063 (yclE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03660 ([gene|955CEAE1FBBABFD683FABB60CF74554AF12019B2|yclE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTCACGCCCCCTTTT, downstream forward: _UP4_TAAAAAACAGCCCGCAGATC
  • BKK03660 ([gene|955CEAE1FBBABFD683FABB60CF74554AF12019B2|yclE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTCACGCCCCCTTTT, downstream forward: _UP4_TAAAAAACAGCCCGCAGATC
  • References

    Research papers

  • 10467172