SubtiBank SubtiBank
comEB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

comEB

dCMP deaminase, late competence protein required for DNA binding and uptake, recruitment of [protein|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|ComGA] to the cell pole
locus
BSU_25580
pI
5.37
mw
20.82 kDa
protein length
189 aa Sequence Blast
gene length
570 bp Sequence Blast
function
recruitment of [protein|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|ComGA] to the cell pole
product
dCMP deaminase
essential
no
synonyms
comD

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    Coordinates
    2,639,877 2,640,446

    The protein

    Catalyzed reaction/ biological activity

  • recruitment of [protein|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|ComGA] to the cell pole [pubmed|31954084]
  • deoxycytidylate monophosphate (dCMP) deaminase [pubmed|31954084]
  • Protein family

  • [SW|Cytidine and deoxycytidylate deaminase family] (according to UniProt)
  • [SW|Domains]

  • [SW|CMP/dCMP-type deaminase domain] (aa 5–132) (according to UniProt)
  • Structure

  • [PDB|2HVV] (from Streptococcus mutans, 50% identity) [pubmed|18255096]
  • [SW|Localization]

  • localizes to one or both cell poles [Pubmed|31954084,21278288]
  • Expression and Regulation

    Operons

    genes
    [gene|788725411B2E741103603373E43441FD036E1BA0|comEA]-[gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]-[gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]
    description
    [Pubmed|7968523,19028902]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7968523], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8196543], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • view in new tab

    Other regulations

  • [protein|F21A75744FA0B25D5A251CB57E7A7DC6ABFF1DC7|ComN]: post-translation control,
  • Biological materials

    Mutant

  • BKE25580 ([gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTGTTCCCTCCAAATG, downstream forward: _UP4_CTTTTCACGAGCTACGTGTG
  • BKK25580 ([gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTGTTCCCTCCAAATG, downstream forward: _UP4_CTTTTCACGAGCTACGTGTG
  • References

  • 11814663,7968523,21278288,19028902,18255096,31954084