SubtiBank SubtiBank
pdhA
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

pdhA

pyruvate dehydrogenase (E1 alpha subunit), required for Z-ring assembly in a pyruvate-dependent manner
locus
BSU14580
pI
5.84
mw
41.39 kDa
protein length
371 aa Sequence Blast
gene length
1113 bp Sequence Blast
function
links glycolysis and TCA cycle
product
pyruvate dehydrogenase (E1 alpha subunit)
essential
no
ec
1.2.4.1
synonyms
aceA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.4|TCA cycle]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    Coordinates
    1,528,326 → 1,529,441

    Phenotypes of a mutant

  • ''pdhA'' is essential according to Kobayashi ''et al''. [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • the mutant grows slowly but is viable [Pubmed|24825009]
  • depletion of ''[gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]'' and deletion of ''[gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]'' have a strong synthetic defect in [SW|cell division] [Pubmed|24825009]
  • The protein

    Catalyzed reaction/ biological activity

  • Pyruvate [dihydrolipoyllysine-residue acetyltransferase] lipoyllysine = [dihydrolipoyllysine-residue acetyltransferase] S-acetyldihydrolipoyllysine CO2 (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|AcoA], [protein|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|BkdAA]
  • Kinetic information

  • Michaelis-Menten [Pubmed|6414463]
  • [SW|Cofactors]

  • thiamine pyrophosphate
  • Effectors of protein activity

  • Inhibited thiamine 2-thiothiazolone diphosphate and NADH [Pubmed|6414463]
  • Low sensibility to NADPH
  • Structure

  • [PDB|1W88] (E1 in complex with subunit binding domain of E2, ''Geobacillus stearothermophilus'')
  • [SW|Localization]

  • colocalizes with the nucleoid (depending on the availability of pyruvate) [Pubmed|24825009]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]-[gene|458E967052D1093A0F48AE0E6B6CCA0F52EAC44D|pdhB]-[gene|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]-[gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]
    description
    [Pubmed|11976308]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20081037], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, due to presence of guanine at 1 position of the transcript [Pubmed|20081037], in [regulon|stringent response|stringent response]
  • regulation

  • ''[protein|search|pdhA]'': expression activated by glucose (1.9-fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE14580 (Δ[gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTAAGTCACCTCTTCC, downstream forward: _UP4_ACACAGAAGGAGTCGAAGTA
  • BKK14580 (Δ[gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTAAGTCACCTCTTCC, downstream forward: _UP4_ACACAGAAGGAGTCGAAGTA
  • lacZ fusion

  • pGP721 (in [protein|search|pAC5]), available in [SW|Stülke] lab, pGP186 (in [protein|search|pAC7]), available in [SW|Stülke] lab
  • Labs working on this gene/protein

  • [SW|Arthur Aronson], Purdue University, West Lafayette, USA [http://wwwdev.gradschool.purdue.edu/PULSe/faculty.cfm?fid=5&range=0 homepage]
  • References

    Reviews

  • 19476487,9655937,2227213,6805383,24798336
  • Original publications

  • 9352926,20525796,12850135,6414463,11976308,20081037,15378759,24825009,28189581,28516784