SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


pyruvate dehydrogenase (E1 alpha subunit), required for Z-ring assembly in a pyruvate-dependent manner
41.39 kDa
protein length
371 aa Sequence Blast
gene length
1116 bp Sequence Blast
links glycolysis and TCA cycle
pyruvate dehydrogenase (E1 alpha subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • Gene

    1,528,326 1,529,441

    Phenotypes of a mutant

  • ''pdhA'' is essential according to Kobayashi ''et al''. [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • the mutant grows slowly but is viable [Pubmed|24825009]
  • depletion of ''[gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]'' and deletion of ''[gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA]'' have a strong synthetic defect in [SW|cell division] [Pubmed|24825009]
  • The protein

    Catalyzed reaction/ biological activity

  • Pyruvate [dihydrolipoyllysine-residue acetyltransferase] lipoyllysine = [dihydrolipoyllysine-residue acetyltransferase] S-acetyldihydrolipoyllysine CO2 (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|BkdAA], [protein|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|AcoA]
  • Kinetic information

  • Michaelis-Menten [Pubmed|6414463]
  • [SW|Cofactors]

  • thiamine pyrophosphate
  • Effectors of protein activity

  • Inhibited thiamine 2-thiothiazolone diphosphate and NADH [Pubmed|6414463]
  • Low sensibility to NADPH
  • Structure

  • [PDB|1W88] (E1 in complex with subunit binding domain of E2, ''Geobacillus stearothermophilus'')
  • [SW|Localization]

  • colocalizes with the nucleoid (depending on the availability of pyruvate) [Pubmed|24825009]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20081037], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, due to presence of guanine at 1 position of the transcript [Pubmed|20081037], in [regulon|stringent response|stringent response]
  • regulation

  • ''[protein|search|pdhA]'': expression activated by glucose (1.9-fold) [Pubmed|12850135]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials


  • BKE14580 ([gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTAAGTCACCTCTTCC, downstream forward: _UP4_ACACAGAAGGAGTCGAAGTA
  • BKK14580 ([gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTAAGTCACCTCTTCC, downstream forward: _UP4_ACACAGAAGGAGTCGAAGTA
  • lacZ fusion

  • pGP721 (in [SW|pAC5]), available in [SW|Jörg Stülke]'s lab, pGP186 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Arthur Aronson], Purdue University, West Lafayette, USA [ homepage]
  • References


  • 19476487,9655937,2227213,6805383,24798336
  • Original publications

  • 9352926,20525796,12850135,6414463,11976308,20081037,15378759,24825009,28189581,28516784,30782632