SubtiBank SubtiBank
spoVAD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

spoVAD

essential for the uptake of the 1:1 chelate of pyridine-2,6-dicarboxylic acid (DPA(2,6)) and Ca(2 ) into developing spores, likely germination protein
locus
BSU_23410
pI
5.24
mw
35.84 kDa
protein length
338 aa Sequence Blast
gene length
1017 bp Sequence Blast
function
likely germination protein
product
binding protein for DPA
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,440,775 2,441,791

    The protein

    Catalyzed reaction/ biological activity

  • maybe involved in spore [SW|germination] [Pubmed|22327596]
  • binding of both DPA(2,6) and Ca(2 )-DPA(2,6) [Pubmed|22328679]
  • Structure

  • [PDB|3LM6]
  • [SW|Localization]

  • outer surface of the inner spore membrane [Pubmed|23335419,16077113]
  • Additional information

  • 6,500 molecules are present per spore [Pubmed|23749970]
  • Expression and Regulation

    Operons

    genes
    [gene|5410018998EC9792A69CF0D9C438EEF5AC8A82C5|spoVAA]-[gene|AEC70413BDC29F435776D532E7049AA9A0BD893D|spoVAB]-[gene|B280951A232E941FB0A6C8834049765BE1E16437|spoVAC]-[gene|9531F0A0DC4AE5696FFBAC9C2A773F15840E3255|spoVAD]-[gene|31D6CB7EC20C39C1815CA4552B8B9C4BE304E86B|spoVAEB]-[gene|B44529B69769D7AF1010E06C95E398EA91A3E798|spoVAEA]-[gene|CBE5093DFBBCE25071CCE12408BC9AFF7A158C03|spoVAF]-[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]
    description
    [Pubmed|7934830]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,1903432], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|15699190,1903432,8755877]
  • view in new tab

    additional information

  • 6,500 molecules are present per spore [PubMed|23749970]
  • Biological materials

    Mutant

  • BKE23410 ([gene|9531F0A0DC4AE5696FFBAC9C2A773F15840E3255|spoVAD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTAATTTCATTTTCTTCT, downstream forward: _UP4_GAGCGTGCAGGAGGTGCATC
  • BKK23410 ([gene|9531F0A0DC4AE5696FFBAC9C2A773F15840E3255|spoVAD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTAATTTCATTTTCTTCT, downstream forward: _UP4_GAGCGTGCAGGAGGTGCATC
  • labs

  • [SW|Peter Setlow], University of Connecticut Health Center, USA
  • References

  • 17573930,3114420,16077113,11751839,15451103,3926949,17158659,6432957,22328679,7934830,15699190,1903432,8755877,22327596,22328679,22493018,23335419,23746146,22343299,23749970,24752279,26731423