SubtiBank SubtiBank
yvpB [2019-02-08 17:09:11]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvpB [2019-02-08 17:09:11]

27.36 kDa
protein length
250 aa Sequence Blast
gene length
753 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,589,611 3,590,363

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A383 (yvpB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34940 ([gene|950D355D993DF79AD5288A00AA04A775637AC04D|yvpB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTATCTCCTTGTTCT, downstream forward: _UP4_TAAACACCTGAAGCCTCACT
  • BKK34940 ([gene|950D355D993DF79AD5288A00AA04A775637AC04D|yvpB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTATCTCCTTGTTCT, downstream forward: _UP4_TAAACACCTGAAGCCTCACT