SubtiBank SubtiBank
yvpB [2019-02-08 17:45:55]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvpB [2019-02-08 17:45:55]

similar to peptidase
locus
BSU34940
pI
8.30
mw
27.36 kDa
protein length
250 aa Sequence Blast
gene length
753 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,589,611 3,590,363

    The protein

    Structure

  • [PDB|3ERV] (corresponds to aa 73 ... 246, 49% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|950D355D993DF79AD5288A00AA04A775637AC04D|yvpB]-[gene|99ECA1B305145A63BD3A72094EF24F56D875BCC1|pelC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A383 (yvpB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/383 NBRP B. subtilis, Japan]
  • BKE34940 ([gene|950D355D993DF79AD5288A00AA04A775637AC04D|yvpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTATCTCCTTGTTCT, downstream forward: _UP4_TAAACACCTGAAGCCTCACT
  • BKK34940 ([gene|950D355D993DF79AD5288A00AA04A775637AC04D|yvpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTATCTCCTTGTTCT, downstream forward: _UP4_TAAACACCTGAAGCCTCACT