SubtiBank SubtiBank
yvpB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvpB

similar to peptidase
locus
BSU_34940
pI
8.30
mw
27.36 kDa
protein length
250 aa Sequence Blast
gene length
753 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,589,611 3,590,363

    The protein

    Structure

  • [PDB|3ERV] (from B. anthracis, corresponds to aa 73 ... 246, 49% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|950D355D993DF79AD5288A00AA04A775637AC04D|yvpB]-[gene|99ECA1B305145A63BD3A72094EF24F56D875BCC1|pelC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A383 (yvpB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/383 NBRP B. subtilis, Japan]
  • BKE34940 ([gene|950D355D993DF79AD5288A00AA04A775637AC04D|yvpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTATCTCCTTGTTCT, downstream forward: _UP4_TAAACACCTGAAGCCTCACT
  • BKK34940 ([gene|950D355D993DF79AD5288A00AA04A775637AC04D|yvpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTATCTCCTTGTTCT, downstream forward: _UP4_TAAACACCTGAAGCCTCACT