SubtiBank SubtiBank
yozL
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yozL

unknown
locus
BSU_18950
pI
4.73
mw
11.35 kDa
protein length
gene length
294 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    2,064,540 2,064,833

    The protein

    Paralogous protein(s)

  • [protein|9BC3DF46C944A0FD5CAAB4513C4AF00EFC5FC8D5|YqjX], [protein|A9D5625FF5F1A3845FF6F8A290F647CCA73D39EF|YolD]
  • Expression and Regulation

    Operons

    genes
    [gene|94F2146AC6998CC77CD2E86CE8BE8DC98AEBB9CD|yozL]-[gene|A04F698C8836E84991BC875BCB7B1460D8E74A8E|yozK]-[gene|ED0A85A8A5FCD12C99507EB033F88586521A7C47|yobH]
    description
    [Pubmed|16267290]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • BKE18950 ([gene|94F2146AC6998CC77CD2E86CE8BE8DC98AEBB9CD|yozL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATGTCCATTGATAGT, downstream forward: _UP4_AATAACATCATAAGAGTTAT
  • BKK18950 ([gene|94F2146AC6998CC77CD2E86CE8BE8DC98AEBB9CD|yozL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATGTCCATTGATAGT, downstream forward: _UP4_AATAACATCATAAGAGTTAT
  • References

  • 16267290,30916324