SubtiBank SubtiBank
yozL
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yozL

unknown
locus
BSU_18950
pI
4.73
mw
11.35 kDa
protein length
gene length
294 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    2,064,540 2,064,833

    The protein

    Paralogous protein(s)

  • [protein|9BC3DF46C944A0FD5CAAB4513C4AF00EFC5FC8D5|YqjX], [protein|A9D5625FF5F1A3845FF6F8A290F647CCA73D39EF|YolD]
  • Expression and Regulation

    Operons

    genes
    [gene|94F2146AC6998CC77CD2E86CE8BE8DC98AEBB9CD|yozL]-[gene|A04F698C8836E84991BC875BCB7B1460D8E74A8E|yozK]-[gene|ED0A85A8A5FCD12C99507EB033F88586521A7C47|yobH]
    description
    [Pubmed|16267290]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • BKE18950 ([gene|94F2146AC6998CC77CD2E86CE8BE8DC98AEBB9CD|yozL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATGTCCATTGATAGT, downstream forward: _UP4_AATAACATCATAAGAGTTAT
  • BKK18950 ([gene|94F2146AC6998CC77CD2E86CE8BE8DC98AEBB9CD|yozL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATGTCCATTGATAGT, downstream forward: _UP4_AATAACATCATAAGAGTTAT
  • References

  • 16267290,30916324