SubtiBank SubtiBank
argG [2019-06-05 10:44:17]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

argG [2019-06-05 10:44:17]

argininosuccinate synthase, reversible
44.66 kDa
protein length
403 aa Sequence Blast
gene length
1212 bp Sequence Blast
biosynthesis of arginine
argininosuccinate synthase, reversible

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of arginine]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    3,013,133 3,014,344

    The protein

    Catalyzed reaction/ biological activity

  • ATP + L-citrulline + L-aspartate = AMP + diphosphate + N(omega)-(L-arginino)succinate (according to Swiss-Prot)
  • Protein family

  • Type 1 subfamily (according to Swiss-Prot)
  • Modification

  • S-cysteinylation after diamide stress (C187) [Pubmed|17611193]
  • phosphorylated on Arg-262 [Pubmed|22517742]
  • Structure

  • [PDB|1KH1] (from ''Thermus thermophilus'', 44% identity, 65% similarity) [Pubmed|11844799]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    regulatory mechanism

  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: repression, in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC])
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials


  • GP1688 Δ([gene|94E5DA4F460FBC02A186D1013C581179F13BCB3E|argG] - [gene|571789ADA1F7B9DE0F9E205E2DEB9C9166F6C312|argH])::''aphA3'', available in [SW|Jörg Stülke]'s lab
  • BKE29450 ([gene|94E5DA4F460FBC02A186D1013C581179F13BCB3E|argG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAAAATCCCCTCTC, downstream forward: _UP4_GCATGAAGAAGCTTTGGGGA
  • BKK29450 ([gene|94E5DA4F460FBC02A186D1013C581179F13BCB3E|argG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAAAATCCCCTCTC, downstream forward: _UP4_GCATGAAGAAGCTTTGGGGA
  • References

  • 17611193,22517742,12107147,22383849,15378759,28516784