SubtiBank SubtiBank
argG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

argG

argininosuccinate synthase, reversible
locus
BSU29450
pI
5.03
mw
44.66 kDa
protein length
403 aa Sequence Blast
gene length
1212 bp Sequence Blast
function
biosynthesis of arginine
product
argininosuccinate synthase, reversible
essential
no
ec
6.3.4.5
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.4|Biosynthesis/ acquisition of arginine]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,013,133 3,014,344

    The protein

    Catalyzed reaction/ biological activity

  • ATP + L-citrulline + L-aspartate = AMP + diphosphate + N(omega)-(L-arginino)succinate (according to Swiss-Prot)
  • Protein family

  • Type 1 subfamily (according to Swiss-Prot)
  • Modification

  • S-cysteinylation after diamide stress (C187) [Pubmed|17611193]
  • phosphorylated on Arg-262 [Pubmed|22517742]
  • Structure

  • [PDB|1KH1] (from ''Thermus thermophilus'', 44% identity, 65% similarity) [Pubmed|11844799]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|94E5DA4F460FBC02A186D1013C581179F13BCB3E|argG]-[gene|571789ADA1F7B9DE0F9E205E2DEB9C9166F6C312|argH]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: repression, in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC])
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • GP1688 Δ([gene|94E5DA4F460FBC02A186D1013C581179F13BCB3E|argG]-[gene|571789ADA1F7B9DE0F9E205E2DEB9C9166F6C312|argH])::''aphA3'', available in [SW|Jörg Stülke]'s lab
  • BKE29450 ([gene|94E5DA4F460FBC02A186D1013C581179F13BCB3E|argG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAAAATCCCCTCTC, downstream forward: _UP4_GCATGAAGAAGCTTTGGGGA
  • BKK29450 ([gene|94E5DA4F460FBC02A186D1013C581179F13BCB3E|argG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAAAATCCCCTCTC, downstream forward: _UP4_GCATGAAGAAGCTTTGGGGA
  • References

  • 17611193,22517742,12107147,22383849,15378759,28516784