SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


O6-methylguanine DNA alkyltransferase
18.61 kDa
protein length
165 aa Sequence Blast
gene length
498 bp Sequence Blast
DNA repair
O6-methylguanine DNA alkyltransferase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    1,421,426 1,421,923

    The protein

    Catalyzed reaction/ biological activity

  • 6-O-methyl-2'-deoxyguanosine in DNA + L-cysteinyl-[protein] --> 2'-deoxyguanosine in DNA + S-methyl-L-cysteinyl-[protein] (according to UniProt)
  • 4-O-methyl-thymidine in DNA + L-cysteinyl-[protein] --> thymidine in DNA + S-methyl-L-cysteinyl-[protein] (according to UniProt)
  • Protein family

  • MGMT family (with [protein|D7E4E4A95CFDB3CFCC7432B08653644AF6876CA1|AdaB], according to UniProt)
  • Structure

  • [PDB|1SFE] (from ''E. coli'', 36% identity, 51% similarity) [Pubmed|8156986]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2506524], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • BKE13540 ([gene|9492D341F54BE019B21C0BAF7465AD8F84CC6F23|ogt]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTTTCGGCTGTCGTATAGT, downstream forward: _UP4_TAAAACATATGGCACGTTCC
  • BKK13540 ([gene|9492D341F54BE019B21C0BAF7465AD8F84CC6F23|ogt]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTTTCGGCTGTCGTATAGT, downstream forward: _UP4_TAAAACATATGGCACGTTCC
  • References

  • 2506524,2105461,9366274