SubtiBank SubtiBank
ogt
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ogt

O6-methylguanine DNA alkyltransferase
locus
BSU_13540
pI
7.09
mw
18.61 kDa
protein length
165 aa Sequence Blast
gene length
498 bp Sequence Blast
function
DNA repair
product
O6-methylguanine DNA alkyltransferase
essential
no
ec
2.1.1.63
synonyms
dat

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    1,421,426 1,421,923

    The protein

    Catalyzed reaction/ biological activity

  • 6-O-methyl-2'-deoxyguanosine in DNA + L-cysteinyl-[protein] --> 2'-deoxyguanosine in DNA + S-methyl-L-cysteinyl-[protein] (according to UniProt)
  • 4-O-methyl-thymidine in DNA + L-cysteinyl-[protein] --> thymidine in DNA + S-methyl-L-cysteinyl-[protein] (according to UniProt)
  • Protein family

  • MGMT family (with [protein|D7E4E4A95CFDB3CFCC7432B08653644AF6876CA1|AdaB], according to UniProt)
  • Structure

  • [PDB|1SFE] (from ''E. coli'', 36% identity, 51% similarity) [Pubmed|8156986]
  • Expression and Regulation

    Operons

    genes
    [gene|1582E81F7DA85F38D6732D341ABD0F052587F25A|kinE]-[gene|9492D341F54BE019B21C0BAF7465AD8F84CC6F23|ogt]
    description
    [Pubmed|2506524]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2506524], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE13540 ([gene|9492D341F54BE019B21C0BAF7465AD8F84CC6F23|ogt]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTTTCGGCTGTCGTATAGT, downstream forward: _UP4_TAAAACATATGGCACGTTCC
  • BKK13540 ([gene|9492D341F54BE019B21C0BAF7465AD8F84CC6F23|ogt]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTTTCGGCTGTCGTATAGT, downstream forward: _UP4_TAAAACATATGGCACGTTCC
  • References

  • 2506524,2105461,9366274