SubtiBank SubtiBank
aprX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

aprX

intracellular alkaline serine protease
locus
BSU_17260
pI
4.97
mw
47.74 kDa
protein length
442 aa Sequence Blast
gene length
1329 bp Sequence Blast
function
protein degradation
product
intracellular alkaline serine protease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.5|Utilization of proteins]
  • Gene

    Coordinates
    1,861,384 1,862,712

    The protein

    Protein family

  • [SW|peptidase S8 family] (according to UniProt)
  • [SW|Domains]

  • [SW|Peptidase S8 domain] (aa 122-439) (according to UniProt)
  • Structure

  • [PDB|3WHI] ([protein|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|AprE], corresponds to aa 78 ... 436, 33% identity) [pubmed|24279884]
  • Expression and Regulation

    Operons

    genes
    [gene|945A1332A020CF842DA590589C88C758DE65C84E|aprX]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10589719], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A019 (aprX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/19 NBRP B. subtilis, Japan]
  • BKE17260 ([gene|945A1332A020CF842DA590589C88C758DE65C84E|aprX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATTTTCCTCCTATTA, downstream forward: _UP4_TAAACATCATCAAAAGCCGG
  • BKK17260 ([gene|945A1332A020CF842DA590589C88C758DE65C84E|aprX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATTTTCCTCCTATTA, downstream forward: _UP4_TAAACATCATCAAAAGCCGG
  • References

  • 10589719,16267290,24279884
  • Labs working on this gene/protein

  • [SW|Alessandra Albertini], University of Pavia, Italy [http://www-1.unipv.it/genbiom/albertini.html homepage]