SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


asparagine synthase (glutamine-hydrolysing)
85.66 kDa
protein length
747 aa Sequence Blast
gene length
2244 bp Sequence Blast
biosynthesis of asparagine
asparagine synthase (glutamine-hydrolysing)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aspartate/ asparagine]
  • Gene

    4,098,926 4,101,169

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + L-aspartate + L-glutamine --> AMP + diphosphate + H+ + L-asparagine + L-glutamate (according to UniProt)
  • Protein family

  • asparagine synthetase family (with [protein|6F5BBCBA02EA1C016AA37EB63D252A4C07CE6617|AsnB] and [protein|15D150B53A25325DBC414F0C2B0D44AEF4B115A9|AsnO], according to UniProt)
  • [SW|Domains]

  • [SW|Glutamine amidotransferase type-2 domain] (aa 2-218) (according to UniProt)
  • Structure

  • [PDB|1CT9] (from E. coli, corresponds to aa 30 ... 537, 27% identity) [pubmed|10587437]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20185509], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (8-fold) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • MGNA-B689 (asnH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39920 ([gene|9446D9C88CBBBC5A08495D8AA49A92A9F47F2C9B|asnH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTCTCCCTCCCAATA, downstream forward: _UP4_AATCTGCCAGAAGGAGCATA
  • BKK39920 ([gene|9446D9C88CBBBC5A08495D8AA49A92A9F47F2C9B|asnH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTCTCCCTCCCAATA, downstream forward: _UP4_AATCTGCCAGAAGGAGCATA
  • References


  • 12859215,11395405
  • Original publications

  • 20185509,10746760,12618455,10498721,12618455,15101989,10587437