SubtiBank SubtiBank
dgkB
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

dgkB

diacylglycerol kinase
locus
BSU06720
pI
5.64
mw
33.18 kDa
protein length
303 aa Sequence Blast
gene length
909 bp Sequence Blast
function
biosynthesis of lipoteichoic acid
product
diacylglycerol kinase
essential
no
ec
2.7.1.107
synonyms
yerQ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.3|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.2|Biosynthesis of lipoteichoic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    Coordinates
    736,436 → 737,347

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Paralogous protein(s)

  • [protein|88AECCE90DC0D6C92C61AB8860A31A830A8DAC42|BmrU]
  • Structure

  • [PDB|3S40] (from ''B. anthracis'', 32% identity, 68% similarity)
  • Biological materials

    Mutant

  • MGNA-B448 (yerQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1447 NBRP B. subtilis, Japan]
  • GP1391 ''dgkB::cat ltaS::aphA3'', available in [SW|Jörg Stülke]'s lab
  • BKE06720 (Δ[gene|943294ACA74067A8549056699E08DF5B82337976|dgkB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATCTCATCATCCTACT, downstream forward: _UP4_TAAAACTTGGCTTGGTAAGC
  • BKK06720 (Δ[gene|943294ACA74067A8549056699E08DF5B82337976|dgkB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATCTCATCATCCTACT, downstream forward: _UP4_TAAAACTTGGCTTGGTAAGC
  • References

    Reviews

  • 24819367
  • Original publications

  • 17535816,22451476,28189581