SubtiBank SubtiBank
ydhB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydhB

unknown
locus
BSU_05690
pI
9.81
mw
27.14 kDa
protein length
245 aa Sequence Blast
gene length
738 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    614,885 615,622

    The protein

    Protein family

  • [SW|4-toluene sulfonate uptake permease (TSUP) (TC 2.A.102) family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|94175E95221B64F07ACA8AD165219930ED90E58B|ydhB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C177 (ydhB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2175 NBRP B. subtilis, Japan]
  • BKE05690 ([gene|94175E95221B64F07ACA8AD165219930ED90E58B|ydhB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTTTCCTCCATTGA, downstream forward: _UP4_TAAATAAAACAAAAAACCTG
  • BKK05690 ([gene|94175E95221B64F07ACA8AD165219930ED90E58B|ydhB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTTTCCTCCATTGA, downstream forward: _UP4_TAAATAAAACAAAAAACCTG