SubtiBank SubtiBank
csrA [2019-09-25 10:56:12]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

csrA [2019-09-25 10:56:12]

motility regulator, binds to the [gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag] mRNA to inhibit its translation, promotes the base pairing between the [gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA and the [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] mRNA
8.00 kDa
protein length
gene length
225 bp Sequence Blast
control of [gene|search|hag ]translation
RNA chaperone, motility regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Additional chemotaxis signal transduction and regulatory proteins]
  • Gene

    3,636,046 3,636,270

    The protein

    Catalyzed reaction/ biological activity

  • [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] binds the ''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' mRNA to inhibit translation [Pubmed|21895793]
  • binds [gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA and [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] mRNA to promote their base pairing and to control arginine metabolism [pubmed|31043113]
  • Protein family

  • CsrA/RsmA family (single member, according to UniProt)
  • Effectors of protein activity

  • [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] is sequestered by interaction with [protein|6A6CBD75DCC33C804F853F47D37773930D398CFE|FliW] (the two proteins form a conserved module in many bacteria) [Pubmed|21895793,27516547]
  • Structure

  • [PDB|1T3O]
  • [PDB|5DMB] ([protein|6A6CBD75DCC33C804F853F47D37773930D398CFE|FliW]-[protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] complex) [Pubmed|27551070]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Additional information

  • [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] and [protein|6A6CBD75DCC33C804F853F47D37773930D398CFE|FliW] form a conserved module in many bacteria [Pubmed|21895793]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8412657], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8045879], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8412657], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|21736639], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19898538], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • view in new tab


    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials


  • MGNA-A392 (csrA::erm), available at the [ NBRP B. subtilis, Japan]
  • GP469 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE35370 ([gene|93F328524989597C7D2329B25E665496C9631E87|csrA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGTTTATTTTCCGCGATA, downstream forward: _UP4_TGAGGATTTTTTTATTTTTG
  • BKK35370 ([gene|93F328524989597C7D2329B25E665496C9631E87|csrA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGTTTATTTTCCGCGATA, downstream forward: _UP4_TGAGGATTTTTTTATTTTTG
  • Expression vectors

  • pGP381 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP383, available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP461 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • References


  • 19385727,22672726,25251856
  • Original Publications

  • 16822857,17555441,8969505,21895793,23144244,26577401,27516547,27551070,31043113,31113895