SubtiBank SubtiBank
csrA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

csrA

motility regulator, binds to the [gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag] mRNA to inhibit its translation, promotes the base pairing between the [gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA and the [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] mRNA
locus
BSU_35370
pI
6.09
mw
8.00 kDa
protein length
gene length
225 bp Sequence Blast
function
control of [gene|search|hag ]translation
product
RNA chaperone, motility regulator
essential
no
synonyms
yviG

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.5|Additional chemotaxis signal transduction and regulatory proteins]
  • Gene

    Coordinates
    3,636,046 3,636,270

    The protein

    Catalyzed reaction/ biological activity

  • [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] binds the ''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' mRNA to inhibit translation [Pubmed|21895793]
  • binds [gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1] RNA and [gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC] mRNA to promote their base pairing and to control arginine metabolism [pubmed|31043113]
  • Protein family

  • CsrA/RsmA family (single member, according to UniProt)
  • [SW|Domains]

  • Contacts FliW via its C-terminus (residues 49-58) (according to UniProt)
  • Effectors of protein activity

  • [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] is sequestered by interaction with [protein|6A6CBD75DCC33C804F853F47D37773930D398CFE|FliW] (the two proteins form a conserved module in many bacteria) [Pubmed|21895793,27516547]
  • Structure

  • [PDB|1T3O]
  • [PDB|5DMB] ([protein|6A6CBD75DCC33C804F853F47D37773930D398CFE|FliW]-[protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] complex) [Pubmed|27551070]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Additional information

  • [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] and [protein|6A6CBD75DCC33C804F853F47D37773930D398CFE|FliW] form a conserved module in many bacteria [Pubmed|21895793]
  • Expression and Regulation

    Operons

    genes
    [gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]-[gene|D290247A43280532947B707F3AF388D7A7F404D3|comFB]-[gene|04D9D70C0BCFDCBD00B5156908C348135080A9C2|comFC]-[gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]-[gene|E5A59D2AF53FA220BA98D9653589A8F0D24F75B8|yviE]-[gene|6A6CBD75DCC33C804F853F47D37773930D398CFE|fliW]-[gene|93F328524989597C7D2329B25E665496C9631E87|csrA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8412657], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8045879], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8412657], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|21736639], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19898538], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • view in new tab

    genes
    [gene|93F328524989597C7D2329B25E665496C9631E87|csrA]
    description
    [Pubmed|8969505]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A392 (csrA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/392 NBRP B. subtilis, Japan]
  • GP469 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE35370 ([gene|93F328524989597C7D2329B25E665496C9631E87|csrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGTTTATTTTCCGCGATA, downstream forward: _UP4_TGAGGATTTTTTTATTTTTG
  • BKK35370 ([gene|93F328524989597C7D2329B25E665496C9631E87|csrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGTTTATTTTCCGCGATA, downstream forward: _UP4_TGAGGATTTTTTTATTTTTG
  • Expression vectors

  • pGP381 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP383, available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP461 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 19385727,22672726,25251856,32850966
  • Original Publications

  • 16822857,17555441,8969505,21895793,23144244,26577401,27516547,27551070,31043113,31113895,33106347