SubtiBank SubtiBank
gerBC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gerBC

lipoprotein, nutrient receptor, germination response to the combination of glucose, fructose, and KCl
locus
BSU35820
pI
9.06
mw
42.31 kDa
protein length
374 aa Sequence Blast
gene length
1125 bp Sequence Blast
function
germination
product
nutrient receptor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.1|Germinant receptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,691,372 3,692,496

    The protein

    Protein family

  • gerABKC lipoprotein family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|D937E26DF69D49B1341B37596AC6A8FBEEF8BA2E|GerAC]
  • [SW|Domains]

  • has an N-terminal signal sequence, lipidated on a Cys residue adjacent to the signal peptide [Pubmed|23335419]
  • Structure

  • [PDB|3N54] [Pubmed|20654628]
  • [SW|Localization]

  • outer surface of the inner spore membrane [Pubmed|23335419,21685283]
  • Additional information

  • 700 molecules are present per spore [Pubmed|23749970]
  • Expression and Regulation

    Operons

    genes
    [gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]-[gene|D70EC7C02BC79BED724489ABCB6356447F215B87|gerBB]-[gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]
    description
    [Pubmed|8012571]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,8012571], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,8012571]
  • additional information

  • 700 molecules are present per spore [PubMed|23749970]
  • view in new tab

    Biological materials

    Mutant

  • BKE35820 ([gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACGGAGAATTTTGATGCTG, downstream forward: _UP4_TAAGCAATCAAAAGGGTGCG
  • BKK35820 ([gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACGGAGAATTTTGATGCTG, downstream forward: _UP4_TAAGCAATCAAAAGGGTGCG
  • References

  • 23396907,16740944,23749970,24752279,7812448,12670969,15774895,15699190,8012571,16352818,20654628,21685283,21696470,22493018,23335419,26731423