SubtiBank SubtiBank
gerBC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

gerBC

lipoprotein, nutrient receptor, germination response to the combination of glucose, fructose, and KCl
locus
BSU_35820
pI
9.06
mw
42.31 kDa
protein length
374 aa Sequence Blast
gene length
1125 bp Sequence Blast
function
germination
product
nutrient receptor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.1|Germinant receptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,691,372 3,692,496

    The protein

    Protein family

  • [SW|GerABKC lipoprotein family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|D937E26DF69D49B1341B37596AC6A8FBEEF8BA2E|GerAC]
  • [SW|Domains]

  • has an N-terminal signal sequence, lipidated on a Cys residue adjacent to the signal peptide [Pubmed|23335419]
  • Structure

  • [PDB|3N54] [Pubmed|20654628]
  • [SW|Localization]

  • outer surface of the inner spore membrane [Pubmed|23335419,21685283]
  • Additional information

  • 700 molecules are present per spore [Pubmed|23749970]
  • Expression and Regulation

    Operons

    genes
    [gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]-[gene|D70EC7C02BC79BED724489ABCB6356447F215B87|gerBB]-[gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]
    description
    [Pubmed|8012571]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,8012571], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,8012571]
  • additional information

  • 700 molecules are present per spore [PubMed|23749970]
  • view in new tab

    Biological materials

    Mutant

  • BKE35820 ([gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACGGAGAATTTTGATGCTG, downstream forward: _UP4_TAAGCAATCAAAAGGGTGCG
  • BKK35820 ([gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACGGAGAATTTTGATGCTG, downstream forward: _UP4_TAAGCAATCAAAAGGGTGCG
  • References

  • 23396907,16740944,23749970,24752279,7812448,12670969,15774895,15699190,8012571,16352818,20654628,21685283,21696470,22493018,23335419,26731423