SubtiBank SubtiBank
iolG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

iolG

inositol 2-dehydrogenase
locus
BSU39700
pI
4.86
mw
38.20 kDa
protein length
344 aa Sequence Blast
gene length
1035 bp Sequence Blast
function
myo-inositol catabolism
product
inositol 2-dehydrogenase
essential
no
ec
1.1.1.18
synonyms
idh,iol

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.16|Utilization of inositol]
  • Gene

    Coordinates
    4,075,785 4,076,819

    The protein

    Catalyzed reaction/ biological activity

  • Myo-inositol + NAD+ = 2,4,6/3,5-pentahydroxycyclohexanone + NADH (according to UniProt)
  • Protein family

  • [SW|Gfo/Idh/MocA family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|942BAE9FA023DFCA06B6D26A856A72F2979E23FA|YrbE], [protein|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|IolX], [protein|03BE6DA854612B3F6741E0E167AB310F0DE96285|YfiI], [protein|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|NtdC], [protein|484D17480DFAD3667E0EBC6D38854A7546A8DB46|YteT], [protein|7DFE74C751A67CCC84579D52005E1399B0A10166|IolW], [protein|920C5750CB95102B073C32874D512E8D636D2C7D|IolU]
  • [SW|Cofactors]

  • NAD+ [Pubmed|20809899]
  • Structure

  • [PDB|3MZ0] [Pubmed|20809899]
  • Expression and Regulation

    Operons

    genes
    [gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]-[gene|0903CCBE053230998A9123F3269868E952C0F76B|iolB]-[gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]-[gene|AA79B6F039EC5B79F4419A5F358AE5AE8292E731|iolD]-[gene|C31AF6C8050D453D9011B0793403791F1851BA69|iolE]-[gene|14813DE6C6DF7AB031BA05AED7D31AE9E8F8498E|iolF]-[gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]-[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]-[gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]-[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]
    description
    [Pubmed|9226270]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9887260,9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B698 (iolG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1697 NBRP B. subtilis, Japan]
  • BKE39700 ([gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGACAGCCACTCCTTCT, downstream forward: _UP4_AACTAAAAAACAGAGGAGTG
  • BKK39700 ([gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGACAGCCACTCCTTCT, downstream forward: _UP4_AACTAAAAAACAGAGGAGTG
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 9226270,6322857,1761221,112095,9887260,18310071,112095,20809899,23952058,24325193,25019153