SubtiBank SubtiBank
mtnE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mtnE

glutamine transaminase
locus
BSU13580
pI
4.91
mw
43.88 kDa
protein length
398 aa Sequence Blast
gene length
1197 bp Sequence Blast
function
methionine salvage
product
glutamine transaminase
essential
no
synonyms
ykrV

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.10|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • Gene

    Coordinates
    1,425,641 1,426,837

    Phenotypes of a mutant

  • reduced growth with 5-methylthioribose as single sulfur source [Pubmed|24837359]
  • The protein

    Catalyzed reaction/ biological activity

  • 2-ketomethylthiobutyrate + glutamine -- 2-ketoglutaramate + methionine [Pubmed|24837359]
  • Protein family

  • [SW|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|99434727013FCCD6E570AE550560A8546F7F2A41|BacF]
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|2O1B] (from Staphylococcus aureus, 42% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|938E08D2C50649A52EC06B9A08C6A73598E68CE1|mtnE]
    description
    [Pubmed|12022921]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12022921], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B321 (ykrV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1320 NBRP B. subtilis, Japan]
  • BKE13580 ([gene|938E08D2C50649A52EC06B9A08C6A73598E68CE1|mtnE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTCTCACCTTCTAA, downstream forward: _UP4_TAACGATGGGATAATTCAAA
  • BKK13580 ([gene|938E08D2C50649A52EC06B9A08C6A73598E68CE1|mtnE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTCTCACCTTCTAA, downstream forward: _UP4_TAACGATGGGATAATTCAAA
  • References

  • 12670965,15102328,12022921,24837359