SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


glutamine transaminase
43.88 kDa
protein length
398 aa Sequence Blast
gene length
1197 bp Sequence Blast
methionine salvage
glutamine transaminase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • Gene

    1,425,641 1,426,837

    Phenotypes of a mutant

  • reduced growth with 5-methylthioribose as single sulfur source [Pubmed|24837359]
  • The protein

    Catalyzed reaction/ biological activity

  • 2-ketomethylthiobutyrate + glutamine -- 2-ketoglutaramate + methionine [Pubmed|24837359]
  • Protein family

  • [SW|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|99434727013FCCD6E570AE550560A8546F7F2A41|BacF]
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|2O1B] (from Staphylococcus aureus, 42% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12022921], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • MGNA-B321 (ykrV::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13580 ([gene|938E08D2C50649A52EC06B9A08C6A73598E68CE1|mtnE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTCTCACCTTCTAA, downstream forward: _UP4_TAACGATGGGATAATTCAAA
  • BKK13580 ([gene|938E08D2C50649A52EC06B9A08C6A73598E68CE1|mtnE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTCTCACCTTCTAA, downstream forward: _UP4_TAACGATGGGATAATTCAAA
  • References

  • 12670965,15102328,12022921,24837359