SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


pyrroline-5-carboxylate reductase
30.24 kDa
protein length
278 aa Sequence Blast
gene length
837 bp Sequence Blast
biosynthesis of proline
pyrroline-5-carboxylate reductase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of proline]
  • Gene

    2,473,151 2,473,987

    The protein

    Catalyzed reaction/ biological activity

  • 1-pyrroline-5-carboxylate + NADPH + H+ --> L-proline + NADP+, activity is biologically not relevant [pubmed|28824574]
  • Protein family

  • [SW|pyrroline-5-carboxylate reductase family] [pubmed|28824574]
  • Paralogous protein(s)

  • [protein|542871C77BE841AA59A65FFE8A44AB85BF9180F0|ProH]
  • [SW|Cofactors]

  • NADPH [pubmed|28824574]
  • Structure

  • [PDB|5BSE] (from ''Medicago truncatula'', 33% identity) [pubmed|26579138]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21233158], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: anti-termination, in [regulon|T-box|T-box]
  • regulation

  • induced by proline limitation ([protein|search|T-box]) [Pubmed|21233158]
  • view in new tab

    Biological materials


  • MGNA-C395 (yqjO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE23800 ([gene|93000B579F630E9F0C6EED40D6661E5E15141FDE|proI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATATCCTCCTTCTAT, downstream forward: _UP4_TAGATGTAAGGACAAAAACA
  • BKK23800 ([gene|93000B579F630E9F0C6EED40D6661E5E15141FDE|proI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATATCCTCCTTCTAT, downstream forward: _UP4_TAGATGTAAGGACAAAAACA
  • References


  • 25367752
  • Original publications

  • 19258532,21233158,11418582,21784929,28752945,28824574,26579138