SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


sporulation-specific diadenylate cyclase, synthesis of c-di-AMP
22.75 kDa
protein length
207 aa Sequence Blast
gene length
624 bp Sequence Blast
synthesis of c-di-AMP
sporulation-specific diadenylate cyclase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    2,118,504 2,119,127

    Phenotypes of a mutant

  • a [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) [pubmed|28420751]
  • The protein

    Catalyzed reaction/ biological activity

  • synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352]
  • 2 ATP --> 3',3'-c-di-AMP + 2 diphosphate (according to UniProt)
  • Protein family

  • adenylate cyclase family (with [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|CdaA], according to UniProt)
  • Paralogous protein(s)

  • [protein|AFE2A9998219162FE32E95628B3CA9071099B61A|CdaA]
  • [SW|Domains]

  • N-terminal autoinhibitory domain [Pubmed|24939848]
  • C-terminal [SW|DAC domain] involved in the synthesis of c-di-AMP [Pubmed|21566650]
  • [SW|DAC domain] (aa 63-205) (according to UniProt)
  • Structure

  • [PDB|2FB5] (the protein of ''B. cereus'', 48% identity, 81% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|22383849], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|22383849]
  • view in new tab

    Biological materials


  • MGNA-B426 (yojJ::erm), available at the [ NBRP B. subtilis, Japan]
  • GP983 (''[gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]''::''ermC''), available in [SW|Jörg Stülke]'s lab [pubmed|23192352]
  • GP1360 (''[gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • GP2222 ([gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::cat [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]::ermC ''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''tet''), available in [SW|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]
  • BKE19430 ([gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCTGTTTAAATTTCC, downstream forward: _UP4_TAAAAATAATAAAAAGGGCC
  • BKK19430 ([gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCCTGTTTAAATTTCC, downstream forward: _UP4_TAAAAATAATAAAAAGGGCC
  • Expression vectors

  • IPTG inducible expression of '''''B. cereus''''' Strep-''cdaS'' in ''E. coli'': pGP2593 (in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • References


  • 25869574,18714086,23812326,30224435
  • Original publications

  • 21566650,23192352,22383849,24939848,26441857