SubtiBank SubtiBank
sleB [2018-12-07 16:34:20]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sleB [2018-12-07 16:34:20]

spore cortex-lytic enzyme
locus
BSU22930
pI
9.51
mw
33.85 kDa
protein length
305 aa Sequence Blast
gene length
915 bp Sequence Blast
function
degration of the spore cortex, germination
product
spore cortex-lytic enzyme
essential
no
synonyms
ypeA

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,399,152 → 2,400,069

    The protein

    Protein family

  • sleB family (according to Swiss-Prot)
  • [SW|Domains]

  • contains a signal peptide [Pubmed|23335419]
  • Structure

  • [PDB|4FET] (from B. anthracis, 50% identity) [pubmed|22777830]
  • [SW|Localization]

  • outer surface of the inner spore membrane [Pubmed|23335419]
  • Expression and Regulation

    Operons

    genes
    [gene|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|sleB]-[gene|F17F7F4330F1B3C609B8E32581DA6EAC6C69752B|ypeB]
    description
    [Pubmed|15699190,10197998]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,10197998], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,10197998]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A399 (sleB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/399 NBRP B. subtilis, Japan]
  • 1G21 ( ''sleB''::''spec''), [Pubmed|11466292], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1G21&Search=1G21 BGSC]
  • BKE22930 (Δ[gene|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|sleB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCAAGCCTCCTAC, downstream forward: _UP4_TAGCAGATATGAGAAAGCAT
  • BKK22930 (Δ[gene|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|sleB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCAAGCCTCCTAC, downstream forward: _UP4_TAGCAGATATGAGAAAGCAT
  • References

  • 16905870,16707666,10197998,25963559,20435722,23335419,23543708,23746146,12177332,10658652,26187959,26731423