SubtiBank SubtiBank
sleB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sleB

spore cortex-lytic enzyme
locus
BSU_22930
pI
9.51
mw
33.85 kDa
protein length
305 aa Sequence Blast
gene length
918 bp Sequence Blast
function
degration of the spore cortex, germination
product
spore cortex-lytic enzyme
essential
no
synonyms
ypeA

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,399,152 2,400,069

    The protein

    Protein family

  • sleB family (single member, according to UniProt)
  • [SW|Domains]

  • contains a signal peptide [Pubmed|23335419]
  • Structure

  • [PDB|4FET] (from B. anthracis, 50% identity) [pubmed|22777830]
  • [SW|Localization]

  • outer surface of the inner spore membrane [Pubmed|23335419]
  • Expression and Regulation

    Operons

    genes
    [gene|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|sleB]-[gene|F17F7F4330F1B3C609B8E32581DA6EAC6C69752B|ypeB]
    description
    [Pubmed|15699190,10197998]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,10197998], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,10197998]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A399 (sleB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/399 NBRP B. subtilis, Japan]
  • 1G21 ( ''sleB''::''spec''), [Pubmed|11466292], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1G21&Search=1G21 BGSC]
  • BKE22930 ([gene|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|sleB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCAAGCCTCCTAC, downstream forward: _UP4_TAGCAGATATGAGAAAGCAT
  • BKK22930 ([gene|92E50EF57FFCB22563B3C3A73B0885CCED8E9692|sleB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCAAGCCTCCTAC, downstream forward: _UP4_TAGCAGATATGAGAAAGCAT
  • References

  • 16905870,16707666,10197998,25963559,20435722,23335419,23543708,23746146,12177332,10658652,26187959,26731423,22777830